Mutagenetix > Incidental Mutation

Incidental Mutation 'R7726:Exph5'

595502

Institutional Source

Beutler Lab

Gene Symbol

Exph5

Ensembl Gene

ENSMUSG00000034584

Gene Name

exophilin 5

Synonyms

Slac2b, AC079869.22gm5, B130009M24Rik, slac2-b

MMRRC Submission

045782-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53301670-53377514 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 53373175 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 519 (V519I)

Ref Sequence

ENSEMBL: ENSMUSP00000062632 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000051014]

AlphaFold

Q0VAV2

Predicted Effect

possibly damaging
Transcript: ENSMUST00000051014
AA Change: V519I

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)

SMART Domains

Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: V519I

Domain	Start	End	E-Value	Type
low complexity region	112	131	N/A	INTRINSIC
low complexity region	454	469	N/A	INTRINSIC
low complexity region	673	682	N/A	INTRINSIC
low complexity region	970	980	N/A	INTRINSIC
low complexity region	1556	1568	N/A	INTRINSIC
low complexity region	1747	1757	N/A	INTRINSIC
low complexity region	1937	1959	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Exph5

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00484:Exph5	APN	9	53376706	nonsense	probably null
IGL01387:Exph5	APN	9	53373965	missense	possibly damaging	0.95
IGL01985:Exph5	APN	9	53376569	missense	probably damaging	0.99
IGL02122:Exph5	APN	9	53373674	missense	probably benign	0.05
IGL02156:Exph5	APN	9	53375641	missense	probably damaging	0.96
IGL02192:Exph5	APN	9	53376325	nonsense	probably null
IGL02491:Exph5	APN	9	53375043	missense	possibly damaging	0.89
PIT4802001:Exph5	UTSW	9	53374978	missense	probably damaging	0.96
R0002:Exph5	UTSW	9	53373956	missense	probably damaging	0.99
R0026:Exph5	UTSW	9	53376479	missense	probably benign	0.38
R0086:Exph5	UTSW	9	53337930	missense	possibly damaging	0.90
R0152:Exph5	UTSW	9	53353204	critical splice donor site	probably null
R0369:Exph5	UTSW	9	53373302	missense	probably benign	0.35
R0409:Exph5	UTSW	9	53374343	missense	probably benign	0.00
R0517:Exph5	UTSW	9	53372762	missense	probably benign	0.02
R0658:Exph5	UTSW	9	53377475	missense	unknown
R1606:Exph5	UTSW	9	53374295	missense	probably benign	0.37
R1739:Exph5	UTSW	9	53375588	missense	possibly damaging	0.62
R1769:Exph5	UTSW	9	53373809	missense	probably benign	0.35
R1828:Exph5	UTSW	9	53376641	missense	possibly damaging	0.79
R1862:Exph5	UTSW	9	53376248	missense	probably benign
R1993:Exph5	UTSW	9	53373635	missense	possibly damaging	0.79
R2012:Exph5	UTSW	9	53367166	missense	possibly damaging	0.49
R2044:Exph5	UTSW	9	53372679	missense	possibly damaging	0.79
R2402:Exph5	UTSW	9	53374925	nonsense	probably null
R3817:Exph5	UTSW	9	53375494	nonsense	probably null
R4771:Exph5	UTSW	9	53373665	missense	possibly damaging	0.95
R4869:Exph5	UTSW	9	53376239	missense	possibly damaging	0.73
R4926:Exph5	UTSW	9	53376625	missense	possibly damaging	0.95
R4996:Exph5	UTSW	9	53375610	missense	possibly damaging	0.79
R5254:Exph5	UTSW	9	53337930	missense	probably damaging	0.99
R5522:Exph5	UTSW	9	53374313	missense	possibly damaging	0.90
R5947:Exph5	UTSW	9	53375222	missense	probably benign	0.04
R5961:Exph5	UTSW	9	53377255	missense	probably damaging	1.00
R6093:Exph5	UTSW	9	53372617	missense	possibly damaging	0.94
R6144:Exph5	UTSW	9	53373028	missense	probably benign	0.21
R6254:Exph5	UTSW	9	53372710	missense	possibly damaging	0.81
R6279:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6300:Exph5	UTSW	9	53373946	missense	possibly damaging	0.78
R6485:Exph5	UTSW	9	53376691	missense	possibly damaging	0.89
R6553:Exph5	UTSW	9	53301712	start gained	probably benign
R6792:Exph5	UTSW	9	53375317	missense	possibly damaging	0.52
R7026:Exph5	UTSW	9	53340428	missense	probably benign	0.27
R7340:Exph5	UTSW	9	53377009	missense	probably damaging	0.99
R7347:Exph5	UTSW	9	53375896	missense	possibly damaging	0.79
R7352:Exph5	UTSW	9	53375722	missense	probably benign	0.00
R7520:Exph5	UTSW	9	53367214	critical splice donor site	probably null
R7521:Exph5	UTSW	9	53374077	missense	possibly damaging	0.89
R7560:Exph5	UTSW	9	53375773	missense	probably benign	0.41
R7581:Exph5	UTSW	9	53372557	missense	possibly damaging	0.90
R7976:Exph5	UTSW	9	53376635	missense	possibly damaging	0.79
R8017:Exph5	UTSW	9	53373452	missense	probably benign
R8019:Exph5	UTSW	9	53373452	missense	probably benign
R8302:Exph5	UTSW	9	53376476	missense	possibly damaging	0.89
R8420:Exph5	UTSW	9	53375848	nonsense	probably null
R8551:Exph5	UTSW	9	53374051	missense	possibly damaging	0.94
R8708:Exph5	UTSW	9	53375796	missense	probably benign
R8889:Exph5	UTSW	9	53376655	missense	probably damaging	1.00
R9048:Exph5	UTSW	9	53373635	missense	possibly damaging	0.79
R9255:Exph5	UTSW	9	53373309	missense	possibly damaging	0.79
R9727:Exph5	UTSW	9	53376402	missense	probably damaging	0.96
X0028:Exph5	UTSW	9	53376263	missense	probably damaging	1.00
Z1177:Exph5	UTSW	9	53374213	missense	probably benign	0.44
Z1177:Exph5	UTSW	9	53377419	missense	probably benign

Predicted Primers

PCR Primer
(F):5'- CCGTCAGAGTAACCCATTTGC -3'
(R):5'- TGGCAGCTTGAGTCAGTTATAG -3'

Sequencing Primer
(F):5'- GTCAGAGTAACCCATTTGCAAGGTC -3'
(R):5'- CAGCTTGAGTCAGTTATAGAAAACCC -3'

Posted On

2019-11-12