Incidental Mutation 'R7726:Exph5'
List |< first << previous [record 23 of 65] next >> last >|
ID595502
Institutional Source Beutler Lab
Gene Symbol Exph5
Ensembl Gene ENSMUSG00000034584
Gene Nameexophilin 5
SynonymsSlac2b, AC079869.22gm5, B130009M24Rik, slac2-b
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7726 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location53301670-53377514 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 53373175 bp
ZygosityHeterozygous
Amino Acid Change Valine to Isoleucine at position 519 (V519I)
Ref Sequence ENSEMBL: ENSMUSP00000062632 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051014]
Predicted Effect possibly damaging
Transcript: ENSMUST00000051014
AA Change: V519I

PolyPhen 2 Score 0.617 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000062632
Gene: ENSMUSG00000034584
AA Change: V519I

DomainStartEndE-ValueType
low complexity region 112 131 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
low complexity region 673 682 N/A INTRINSIC
low complexity region 970 980 N/A INTRINSIC
low complexity region 1556 1568 N/A INTRINSIC
low complexity region 1747 1757 N/A INTRINSIC
low complexity region 1937 1959 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the synaptotagmin-like protein (Slp) family lacking a C2 domain. It contains an N-terminal synaptotagmin-like homology domain (SHD), and is a ras-related protein Rab-27B effector protein. This protein is thought to be involved in exosome secretion and intracellular vesicle trafficking. Reduced expression of this gene results in keratin filament defects. Mutations in this gene have been associated with some cases of epidermolysis bullosa, an inherited skin fragility disorder. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Aug 2015]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Exph5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00484:Exph5 APN 9 53376706 nonsense probably null
IGL01387:Exph5 APN 9 53373965 missense possibly damaging 0.95
IGL01985:Exph5 APN 9 53376569 missense probably damaging 0.99
IGL02122:Exph5 APN 9 53373674 missense probably benign 0.05
IGL02156:Exph5 APN 9 53375641 missense probably damaging 0.96
IGL02192:Exph5 APN 9 53376325 nonsense probably null
IGL02491:Exph5 APN 9 53375043 missense possibly damaging 0.89
PIT4802001:Exph5 UTSW 9 53374978 missense probably damaging 0.96
R0002:Exph5 UTSW 9 53373956 missense probably damaging 0.99
R0026:Exph5 UTSW 9 53376479 missense probably benign 0.38
R0086:Exph5 UTSW 9 53337930 missense possibly damaging 0.90
R0152:Exph5 UTSW 9 53353204 critical splice donor site probably null
R0369:Exph5 UTSW 9 53373302 missense probably benign 0.35
R0409:Exph5 UTSW 9 53374343 missense probably benign 0.00
R0517:Exph5 UTSW 9 53372762 missense probably benign 0.02
R0658:Exph5 UTSW 9 53377475 missense unknown
R1606:Exph5 UTSW 9 53374295 missense probably benign 0.37
R1739:Exph5 UTSW 9 53375588 missense possibly damaging 0.62
R1769:Exph5 UTSW 9 53373809 missense probably benign 0.35
R1828:Exph5 UTSW 9 53376641 missense possibly damaging 0.79
R1862:Exph5 UTSW 9 53376248 missense probably benign
R1993:Exph5 UTSW 9 53373635 missense possibly damaging 0.79
R2012:Exph5 UTSW 9 53367166 missense possibly damaging 0.49
R2044:Exph5 UTSW 9 53372679 missense possibly damaging 0.79
R2402:Exph5 UTSW 9 53374925 nonsense probably null
R3817:Exph5 UTSW 9 53375494 nonsense probably null
R4771:Exph5 UTSW 9 53373665 missense possibly damaging 0.95
R4869:Exph5 UTSW 9 53376239 missense possibly damaging 0.73
R4926:Exph5 UTSW 9 53376625 missense possibly damaging 0.95
R4996:Exph5 UTSW 9 53375610 missense possibly damaging 0.79
R5254:Exph5 UTSW 9 53337930 missense probably damaging 0.99
R5522:Exph5 UTSW 9 53374313 missense possibly damaging 0.90
R5947:Exph5 UTSW 9 53375222 missense probably benign 0.04
R5961:Exph5 UTSW 9 53377255 missense probably damaging 1.00
R6093:Exph5 UTSW 9 53372617 missense possibly damaging 0.94
R6144:Exph5 UTSW 9 53373028 missense probably benign 0.21
R6254:Exph5 UTSW 9 53372710 missense possibly damaging 0.81
R6279:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6300:Exph5 UTSW 9 53373946 missense possibly damaging 0.78
R6485:Exph5 UTSW 9 53376691 missense possibly damaging 0.89
R6553:Exph5 UTSW 9 53301712 start gained probably benign
R6792:Exph5 UTSW 9 53375317 missense possibly damaging 0.52
R7026:Exph5 UTSW 9 53340428 missense probably benign 0.27
R7340:Exph5 UTSW 9 53377009 missense probably damaging 0.99
R7347:Exph5 UTSW 9 53375896 missense possibly damaging 0.79
R7352:Exph5 UTSW 9 53375722 missense probably benign 0.00
R7520:Exph5 UTSW 9 53367214 critical splice donor site probably null
R7521:Exph5 UTSW 9 53374077 missense possibly damaging 0.89
R7560:Exph5 UTSW 9 53375773 missense probably benign 0.41
R7581:Exph5 UTSW 9 53372557 missense possibly damaging 0.90
R8019:Exph5 UTSW 9 53373452 missense probably benign
X0028:Exph5 UTSW 9 53376263 missense probably damaging 1.00
Z1177:Exph5 UTSW 9 53374213 missense probably benign 0.44
Z1177:Exph5 UTSW 9 53377419 missense probably benign
Predicted Primers PCR Primer
(F):5'- CCGTCAGAGTAACCCATTTGC -3'
(R):5'- TGGCAGCTTGAGTCAGTTATAG -3'

Sequencing Primer
(F):5'- GTCAGAGTAACCCATTTGCAAGGTC -3'
(R):5'- CAGCTTGAGTCAGTTATAGAAAACCC -3'
Posted On2019-11-12