Incidental Mutation 'R7726:Alas1'
ID 595503
Institutional Source Beutler Lab
Gene Symbol Alas1
Ensembl Gene ENSMUSG00000032786
Gene Name aminolevulinic acid synthase 1
Synonyms succinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N, 5-aminolevulinate synthase
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 106233455-106248654 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 106246951 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Threonine to Alanine at position 3 (T3A)
Ref Sequence ENSEMBL: ENSMUSP00000108143 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074082] [ENSMUST00000112524] [ENSMUST00000133617] [ENSMUST00000141118] [ENSMUST00000215222] [ENSMUST00000219129]
AlphaFold Q8VC19
Predicted Effect probably benign
Transcript: ENSMUST00000074082
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000073725
Gene: ENSMUSG00000032786
AA Change: T3A

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 81 1.1e-21 PFAM
Pfam:Preseq_ALAS 73 141 2.8e-12 PFAM
Pfam:Aminotran_1_2 245 591 2.1e-77 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000112524
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000108143
Gene: ENSMUSG00000032786
AA Change: T3A

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 2 140 1.3e-49 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Cys_Met_Meta_PP 283 423 1.5e-6 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000122117
Gene: ENSMUSG00000032786
AA Change: T3A

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 79 3.1e-22 PFAM
Pfam:Preseq_ALAS 73 141 8.7e-13 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000141118
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000117014
Gene: ENSMUSG00000032786
AA Change: T3A

DomainStartEndE-ValueType
Pfam:Preseq_ALAS 1 81 1.7e-20 PFAM
Pfam:Preseq_ALAS 73 141 4.2e-11 PFAM
Pfam:Aminotran_1_2 245 592 5.3e-80 PFAM
Pfam:Aminotran_5 257 422 3.4e-6 PFAM
Pfam:Cys_Met_Meta_PP 285 423 1.8e-6 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000215222
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Predicted Effect probably benign
Transcript: ENSMUST00000219129
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Meta Mutation Damage Score 0.0846 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Alas1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00911:Alas1 APN 9 106236472 missense probably benign 0.17
IGL02165:Alas1 APN 9 106238783 missense probably damaging 1.00
IGL02355:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02362:Alas1 APN 9 106236639 missense probably damaging 1.00
IGL02499:Alas1 APN 9 106241321 missense probably damaging 1.00
IGL02606:Alas1 APN 9 106241110 unclassified probably benign
IGL03121:Alas1 APN 9 106246914 missense probably damaging 0.99
R0115:Alas1 UTSW 9 106238252 splice site probably null
R0294:Alas1 UTSW 9 106241256 missense probably damaging 1.00
R0333:Alas1 UTSW 9 106241281 missense probably benign 0.08
R0346:Alas1 UTSW 9 106243351 missense possibly damaging 0.78
R1700:Alas1 UTSW 9 106239646 missense possibly damaging 0.46
R1982:Alas1 UTSW 9 106238185 missense probably damaging 1.00
R2056:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2058:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2059:Alas1 UTSW 9 106241290 missense probably damaging 1.00
R2355:Alas1 UTSW 9 106236474 missense probably damaging 0.96
R2516:Alas1 UTSW 9 106238660 missense probably damaging 1.00
R3896:Alas1 UTSW 9 106241801 splice site probably null
R4091:Alas1 UTSW 9 106241801 splice site probably null
R4093:Alas1 UTSW 9 106241801 splice site probably null
R4095:Alas1 UTSW 9 106241801 splice site probably null
R4673:Alas1 UTSW 9 106236477 missense probably damaging 1.00
R4948:Alas1 UTSW 9 106246878 nonsense probably null
R5165:Alas1 UTSW 9 106241255 missense probably damaging 1.00
R5215:Alas1 UTSW 9 106243375 missense probably benign 0.05
R5420:Alas1 UTSW 9 106234159 missense probably benign 0.13
R5993:Alas1 UTSW 9 106234129 missense probably benign 0.11
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R6033:Alas1 UTSW 9 106241204 missense probably damaging 1.00
R7489:Alas1 UTSW 9 106241634 critical splice donor site probably null
R8012:Alas1 UTSW 9 106246763 missense probably benign
R8036:Alas1 UTSW 9 106235522 missense probably benign 0.19
R8353:Alas1 UTSW 9 106236522 missense possibly damaging 0.83
R8453:Alas1 UTSW 9 106236522 missense possibly damaging 0.83
R8928:Alas1 UTSW 9 106241314 missense probably benign
R9015:Alas1 UTSW 9 106236471 missense probably benign 0.17
R9259:Alas1 UTSW 9 106241636 missense probably benign 0.01
R9475:Alas1 UTSW 9 106234062 missense probably benign 0.08
R9516:Alas1 UTSW 9 106238641 critical splice donor site probably null
R9797:Alas1 UTSW 9 106236643 missense probably damaging 1.00
Z1176:Alas1 UTSW 9 106238769 missense probably benign 0.42
Z1176:Alas1 UTSW 9 106243367 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TCTTTGACCTGCTGGCAGTG -3'
(R):5'- TACTCTGGTAAACTTGCTTAGGG -3'

Sequencing Primer
(F):5'- CTGGCAGTGGACAGCTGATG -3'
(R):5'- GGGTTTCTGTAAAGGTAGAGAATG -3'
Posted On 2019-11-12