Mutagenetix > Incidental Mutation

Incidental Mutation 'R7726:Alas1'

595503

Institutional Source

Beutler Lab

Gene Symbol

Alas1

Ensembl Gene

ENSMUSG00000032786

Gene Name

aminolevulinic acid synthase 1

Synonyms

succinyl-CoA: glycine C-succinyl transferase, Alas-1, ALAS-N, 5-aminolevulinate synthase

MMRRC Submission

Accession Numbers

Is this an essential gene?

Essential (E-score: 1.000) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106233455-106248654 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106246951 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Alanine at position 3 (T3A)

Ref Sequence

ENSEMBL: ENSMUSP00000108143 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000074082] [ENSMUST00000112524] [ENSMUST00000133617] [ENSMUST00000141118] [ENSMUST00000215222] [ENSMUST00000219129]

AlphaFold

Q8VC19

Predicted Effect

probably benign
Transcript: ENSMUST00000074082
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000073725
Gene: ENSMUSG00000032786
AA Change: T3A

Domain	Start	End	E-Value	Type
Pfam:Preseq_ALAS	1	81	1.1e-21	PFAM
Pfam:Preseq_ALAS	73	141	2.8e-12	PFAM
Pfam:Aminotran_1_2	245	591	2.1e-77	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000112524
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000108143
Gene: ENSMUSG00000032786
AA Change: T3A

Domain	Start	End	E-Value	Type
Pfam:Preseq_ALAS	2	140	1.3e-49	PFAM
Pfam:Aminotran_1_2	245	592	5.3e-80	PFAM
Pfam:Cys_Met_Meta_PP	283	423	1.5e-6	PFAM

Predicted Effect

SMART Domains

Protein: ENSMUSP00000122117
Gene: ENSMUSG00000032786
AA Change: T3A

Domain	Start	End	E-Value	Type
Pfam:Preseq_ALAS	1	79	3.1e-22	PFAM
Pfam:Preseq_ALAS	73	141	8.7e-13	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000141118
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

SMART Domains

Protein: ENSMUSP00000117014
Gene: ENSMUSG00000032786
AA Change: T3A

Domain	Start	End	E-Value	Type
Pfam:Preseq_ALAS	1	81	1.7e-20	PFAM
Pfam:Preseq_ALAS	73	141	4.2e-11	PFAM
Pfam:Aminotran_1_2	245	592	5.3e-80	PFAM
Pfam:Aminotran_5	257	422	3.4e-6	PFAM
Pfam:Cys_Met_Meta_PP	285	423	1.8e-6	PFAM

Predicted Effect

probably benign
Transcript: ENSMUST00000215222
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Predicted Effect

probably benign
Transcript: ENSMUST00000219129
AA Change: T3A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes the mitochondrial enzyme which is catalyzes the rate-limiting step in heme (iron-protoporphyrin) biosynthesis. The enzyme encoded by this gene is the housekeeping enzyme; a separate gene encodes a form of the enzyme that is specific for erythroid tissue. The level of the mature encoded protein is regulated by heme: high levels of heme down-regulate the mature enzyme in mitochondria while low heme levels up-regulate. A pseudogene of this gene is located on chromosome 12. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jan 2015]
PHENOTYPE: Mice homozygous for a reporter allele exhibit embryonic lethality. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Alas1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00911:Alas1	APN	9	106236472	missense	probably benign	0.17
IGL02165:Alas1	APN	9	106238783	missense	probably damaging	1.00
IGL02355:Alas1	APN	9	106236639	missense	probably damaging	1.00
IGL02362:Alas1	APN	9	106236639	missense	probably damaging	1.00
IGL02499:Alas1	APN	9	106241321	missense	probably damaging	1.00
IGL02606:Alas1	APN	9	106241110	unclassified	probably benign
IGL03121:Alas1	APN	9	106246914	missense	probably damaging	0.99
R0115:Alas1	UTSW	9	106238252	splice site	probably null
R0294:Alas1	UTSW	9	106241256	missense	probably damaging	1.00
R0333:Alas1	UTSW	9	106241281	missense	probably benign	0.08
R0346:Alas1	UTSW	9	106243351	missense	possibly damaging	0.78
R1700:Alas1	UTSW	9	106239646	missense	possibly damaging	0.46
R1982:Alas1	UTSW	9	106238185	missense	probably damaging	1.00
R2056:Alas1	UTSW	9	106241290	missense	probably damaging	1.00
R2058:Alas1	UTSW	9	106241290	missense	probably damaging	1.00
R2059:Alas1	UTSW	9	106241290	missense	probably damaging	1.00
R2355:Alas1	UTSW	9	106236474	missense	probably damaging	0.96
R2516:Alas1	UTSW	9	106238660	missense	probably damaging	1.00
R3896:Alas1	UTSW	9	106241801	splice site	probably null
R4091:Alas1	UTSW	9	106241801	splice site	probably null
R4093:Alas1	UTSW	9	106241801	splice site	probably null
R4095:Alas1	UTSW	9	106241801	splice site	probably null
R4673:Alas1	UTSW	9	106236477	missense	probably damaging	1.00
R4948:Alas1	UTSW	9	106246878	nonsense	probably null
R5165:Alas1	UTSW	9	106241255	missense	probably damaging	1.00
R5215:Alas1	UTSW	9	106243375	missense	probably benign	0.05
R5420:Alas1	UTSW	9	106234159	missense	probably benign	0.13
R5993:Alas1	UTSW	9	106234129	missense	probably benign	0.11
R6033:Alas1	UTSW	9	106241204	missense	probably damaging	1.00
R6033:Alas1	UTSW	9	106241204	missense	probably damaging	1.00
R7489:Alas1	UTSW	9	106241634	critical splice donor site	probably null
R8012:Alas1	UTSW	9	106246763	missense	probably benign
R8036:Alas1	UTSW	9	106235522	missense	probably benign	0.19
R8353:Alas1	UTSW	9	106236522	missense	possibly damaging	0.83
R8453:Alas1	UTSW	9	106236522	missense	possibly damaging	0.83
R8928:Alas1	UTSW	9	106241314	missense	probably benign
R9015:Alas1	UTSW	9	106236471	missense	probably benign	0.17
R9259:Alas1	UTSW	9	106241636	missense	probably benign	0.01
R9475:Alas1	UTSW	9	106234062	missense	probably benign	0.08
R9516:Alas1	UTSW	9	106238641	critical splice donor site	probably null
R9797:Alas1	UTSW	9	106236643	missense	probably damaging	1.00
Z1176:Alas1	UTSW	9	106238769	missense	probably benign	0.42
Z1176:Alas1	UTSW	9	106243367	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TCTTTGACCTGCTGGCAGTG -3'
(R):5'- TACTCTGGTAAACTTGCTTAGGG -3'

Sequencing Primer
(F):5'- CTGGCAGTGGACAGCTGATG -3'
(R):5'- GGGTTTCTGTAAAGGTAGAGAATG -3'

Posted On

2019-11-12