Incidental Mutation 'R7726:Ccdc162'
ID 595504
Institutional Source Beutler Lab
Gene Symbol Ccdc162
Ensembl Gene ENSMUSG00000075225
Gene Name coiled-coil domain containing 162
Synonyms Gm29096, Gm6976, 5033413D22Rik
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.070) question?
Stock # R7726 (G1)
Quality Score 209.009
Status Not validated
Chromosome 10
Chromosomal Location 41414838-41592586 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 41429071 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Leucine at position 1937 (M1937L)
Ref Sequence ENSEMBL: ENSMUSP00000140774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019955] [ENSMUST00000099932] [ENSMUST00000179614] [ENSMUST00000189488] [ENSMUST00000219054]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000019955
SMART Domains Protein: ENSMUSP00000019955
Gene: ENSMUSG00000075225

DomainStartEndE-ValueType
coiled coil region 1 37 N/A INTRINSIC
low complexity region 116 138 N/A INTRINSIC
coiled coil region 177 217 N/A INTRINSIC
Predicted Effect
SMART Domains Protein: ENSMUSP00000092852
Gene: ENSMUSG00000075225
AA Change: M287L

DomainStartEndE-ValueType
coiled coil region 140 179 N/A INTRINSIC
low complexity region 304 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000099932
AA Change: M474L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000097516
Gene: ENSMUSG00000075225
AA Change: M474L

DomainStartEndE-ValueType
coiled coil region 327 366 N/A INTRINSIC
low complexity region 490 512 N/A INTRINSIC
coiled coil region 551 607 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000179614
AA Change: M664L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000135966
Gene: ENSMUSG00000075225
AA Change: M664L

DomainStartEndE-ValueType
coiled coil region 517 556 N/A INTRINSIC
low complexity region 680 702 N/A INTRINSIC
coiled coil region 741 797 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000189488
AA Change: M1937L

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000140774
Gene: ENSMUSG00000075225
AA Change: M1937L

DomainStartEndE-ValueType
low complexity region 328 347 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000219054
AA Change: M664L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Ccdc162
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01013:Ccdc162 APN 10 41,457,335 (GRCm39) missense probably benign 0.01
IGL01366:Ccdc162 APN 10 41,456,302 (GRCm39) missense possibly damaging 0.49
IGL01924:Ccdc162 APN 10 41,445,883 (GRCm39) missense probably damaging 1.00
IGL02504:Ccdc162 APN 10 41,428,384 (GRCm39) missense probably damaging 1.00
IGL02678:Ccdc162 APN 10 41,437,151 (GRCm39) missense probably damaging 0.99
IGL02955:Ccdc162 APN 10 41,437,123 (GRCm39) missense probably damaging 1.00
beeswax UTSW 10 41,437,222 (GRCm39) missense possibly damaging 0.57
honeycomb UTSW 10 41,520,637 (GRCm39) missense probably benign 0.35
FR4304:Ccdc162 UTSW 10 41,432,117 (GRCm39) missense possibly damaging 0.49
R0432:Ccdc162 UTSW 10 41,417,856 (GRCm39) missense probably benign 0.01
R0585:Ccdc162 UTSW 10 41,462,375 (GRCm39) missense probably benign 0.03
R0645:Ccdc162 UTSW 10 41,462,407 (GRCm39) splice site probably benign
R0731:Ccdc162 UTSW 10 41,455,139 (GRCm39) missense probably damaging 1.00
R1426:Ccdc162 UTSW 10 41,429,178 (GRCm39) missense possibly damaging 0.89
R1447:Ccdc162 UTSW 10 41,456,243 (GRCm39) missense probably damaging 1.00
R1712:Ccdc162 UTSW 10 41,415,427 (GRCm39) missense probably benign 0.35
R2138:Ccdc162 UTSW 10 41,457,293 (GRCm39) missense probably benign 0.15
R2351:Ccdc162 UTSW 10 41,431,968 (GRCm39) critical splice donor site probably null
R2394:Ccdc162 UTSW 10 41,445,894 (GRCm39) missense probably damaging 1.00
R2431:Ccdc162 UTSW 10 41,445,841 (GRCm39) missense probably benign
R2571:Ccdc162 UTSW 10 41,428,393 (GRCm39) missense probably damaging 1.00
R2873:Ccdc162 UTSW 10 41,531,095 (GRCm39) missense possibly damaging 0.68
R2926:Ccdc162 UTSW 10 41,437,203 (GRCm39) start gained probably benign
R2999:Ccdc162 UTSW 10 41,456,286 (GRCm39) missense probably benign 0.00
R3412:Ccdc162 UTSW 10 41,415,545 (GRCm39) splice site probably benign
R3712:Ccdc162 UTSW 10 41,463,375 (GRCm39) missense probably benign
R3736:Ccdc162 UTSW 10 41,465,564 (GRCm39) splice site probably null
R4112:Ccdc162 UTSW 10 41,532,324 (GRCm39) missense possibly damaging 0.77
R4557:Ccdc162 UTSW 10 41,463,384 (GRCm39) missense probably benign 0.01
R4580:Ccdc162 UTSW 10 41,437,136 (GRCm39) missense probably benign 0.02
R4685:Ccdc162 UTSW 10 41,557,682 (GRCm39) missense possibly damaging 0.89
R4837:Ccdc162 UTSW 10 41,549,863 (GRCm39) missense probably benign 0.00
R5155:Ccdc162 UTSW 10 41,455,147 (GRCm39) missense probably damaging 1.00
R5155:Ccdc162 UTSW 10 41,429,576 (GRCm39) splice site probably null
R5645:Ccdc162 UTSW 10 41,428,352 (GRCm39) missense probably benign 0.06
R5656:Ccdc162 UTSW 10 41,445,930 (GRCm39) missense probably benign 0.26
R5682:Ccdc162 UTSW 10 41,432,799 (GRCm39) nonsense probably null
R5808:Ccdc162 UTSW 10 41,531,500 (GRCm39) missense possibly damaging 0.62
R5909:Ccdc162 UTSW 10 41,437,111 (GRCm39) missense probably damaging 1.00
R6000:Ccdc162 UTSW 10 41,437,159 (GRCm39) missense possibly damaging 0.75
R6057:Ccdc162 UTSW 10 41,510,037 (GRCm39) missense possibly damaging 0.72
R6211:Ccdc162 UTSW 10 41,506,141 (GRCm39) nonsense probably null
R6264:Ccdc162 UTSW 10 41,570,464 (GRCm39) missense probably benign 0.31
R6329:Ccdc162 UTSW 10 41,539,147 (GRCm39) missense possibly damaging 0.76
R6349:Ccdc162 UTSW 10 41,570,396 (GRCm39) missense probably damaging 0.97
R6398:Ccdc162 UTSW 10 41,503,145 (GRCm39) missense probably damaging 1.00
R6453:Ccdc162 UTSW 10 41,426,821 (GRCm39) missense probably damaging 1.00
R6602:Ccdc162 UTSW 10 41,491,976 (GRCm39) missense probably benign 0.00
R6627:Ccdc162 UTSW 10 41,539,181 (GRCm39) missense probably damaging 1.00
R6722:Ccdc162 UTSW 10 41,520,637 (GRCm39) missense probably benign 0.35
R6750:Ccdc162 UTSW 10 41,437,222 (GRCm39) missense possibly damaging 0.57
R6968:Ccdc162 UTSW 10 41,549,840 (GRCm39) missense possibly damaging 0.55
R6970:Ccdc162 UTSW 10 41,491,954 (GRCm39) missense probably benign 0.03
R6989:Ccdc162 UTSW 10 41,457,349 (GRCm39) missense probably damaging 0.99
R7008:Ccdc162 UTSW 10 41,428,411 (GRCm39) missense probably damaging 1.00
R7135:Ccdc162 UTSW 10 41,549,855 (GRCm39) missense probably benign 0.00
R7139:Ccdc162 UTSW 10 41,542,717 (GRCm39) missense possibly damaging 0.49
R7224:Ccdc162 UTSW 10 41,437,187 (GRCm39) missense probably damaging 1.00
R7230:Ccdc162 UTSW 10 41,554,809 (GRCm39) missense probably damaging 1.00
R7256:Ccdc162 UTSW 10 41,431,997 (GRCm39) missense probably damaging 0.99
R7261:Ccdc162 UTSW 10 41,437,136 (GRCm39) missense probably benign 0.02
R7390:Ccdc162 UTSW 10 41,510,044 (GRCm39) missense probably benign
R7712:Ccdc162 UTSW 10 41,503,223 (GRCm39) missense possibly damaging 0.56
R7754:Ccdc162 UTSW 10 41,463,371 (GRCm39) missense probably damaging 1.00
R7764:Ccdc162 UTSW 10 41,566,109 (GRCm39) missense possibly damaging 0.95
R8053:Ccdc162 UTSW 10 41,520,577 (GRCm39) missense probably benign
R8088:Ccdc162 UTSW 10 41,499,410 (GRCm39) missense possibly damaging 0.68
R8094:Ccdc162 UTSW 10 41,488,864 (GRCm39) missense probably benign 0.02
R8097:Ccdc162 UTSW 10 41,510,115 (GRCm39) missense probably benign 0.03
R8321:Ccdc162 UTSW 10 41,510,029 (GRCm39) missense probably damaging 0.98
R8377:Ccdc162 UTSW 10 41,457,306 (GRCm39) missense probably benign 0.08
R8399:Ccdc162 UTSW 10 41,415,517 (GRCm39) missense probably damaging 1.00
R8669:Ccdc162 UTSW 10 41,428,352 (GRCm39) missense probably benign 0.06
R8772:Ccdc162 UTSW 10 41,506,033 (GRCm39) missense probably damaging 0.99
R8810:Ccdc162 UTSW 10 41,542,737 (GRCm39) missense probably benign 0.41
R8903:Ccdc162 UTSW 10 41,531,440 (GRCm39) critical splice donor site probably null
R8928:Ccdc162 UTSW 10 41,462,245 (GRCm39) splice site probably benign
R8950:Ccdc162 UTSW 10 41,474,507 (GRCm39) missense probably benign 0.00
R8960:Ccdc162 UTSW 10 41,429,178 (GRCm39) missense probably damaging 0.96
R8985:Ccdc162 UTSW 10 41,432,102 (GRCm39) missense probably damaging 1.00
R9071:Ccdc162 UTSW 10 41,457,174 (GRCm39) nonsense probably null
R9254:Ccdc162 UTSW 10 41,488,944 (GRCm39) critical splice acceptor site probably null
R9297:Ccdc162 UTSW 10 41,506,110 (GRCm39) missense probably benign
R9318:Ccdc162 UTSW 10 41,506,110 (GRCm39) missense probably benign
R9518:Ccdc162 UTSW 10 41,465,572 (GRCm39) missense probably damaging 1.00
R9525:Ccdc162 UTSW 10 41,559,222 (GRCm39) missense probably damaging 0.99
R9539:Ccdc162 UTSW 10 41,463,407 (GRCm39) missense possibly damaging 0.54
R9638:Ccdc162 UTSW 10 41,437,159 (GRCm39) missense probably benign 0.01
Z1176:Ccdc162 UTSW 10 41,530,993 (GRCm39) missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41,481,104 (GRCm39) missense possibly damaging 0.84
Z1176:Ccdc162 UTSW 10 41,429,127 (GRCm39) missense probably benign 0.00
Z1176:Ccdc162 UTSW 10 41,566,088 (GRCm39) missense probably benign 0.00
Z1177:Ccdc162 UTSW 10 41,559,191 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAACACTCTAAGGTTGCCTGTTC -3'
(R):5'- TCTGGTGTTAGGGAAAGGACC -3'

Sequencing Primer
(F):5'- CTAAGGTTGCCTGTTCCCAGAAG -3'
(R):5'- ACCGAAAGTGGCCTGTTC -3'
Posted On 2019-11-12