Mutagenetix > Incidental Mutation

Incidental Mutation 'R7726:Ntn4'

595506

Institutional Source

Beutler Lab

Gene Symbol

Ntn4

Ensembl Gene

ENSMUSG00000020019

Gene Name

netrin 4

Synonyms

beta-netrin

MMRRC Submission

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

93640681-93747207 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

A to G at 93733682 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Aspartic acid to Glycine at position 419 (D419G)

Ref Sequence

ENSEMBL: ENSMUSP00000020204 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000020204]

AlphaFold

Q9JI33

Predicted Effect

possibly damaging
Transcript: ENSMUST00000020204
AA Change: D419G

PolyPhen 2 Score 0.817 (Sensitivity: 0.84; Specificity: 0.93)

SMART Domains

Protein: ENSMUSP00000020204
Gene: ENSMUSG00000020019
AA Change: D419G

Domain	Start	End	E-Value	Type
signal peptide	1	19	N/A	INTRINSIC
LamNT	28	260	6.48e-55	SMART
EGF_Lam	262	329	5.83e-7	SMART
EGF_Lam	332	392	3.32e-11	SMART
EGF_Lam	395	446	3.73e-14	SMART
C345C	516	625	5.58e-25	SMART

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the netrin family of proteins, which function in various biological processes including axon guidance, tumorogenesis, and angiogenesis. Netrins are laminin-related proteins that have an N-terminal laminin-type domain, epidermal growth factor-like repeat domain, and a positively charged heparin-binding domain at the C-terminus. The protein encoded by this gene is involved in processes including neurite growth and migration, angiogenesis and mural cell adhesion to endothelial cells. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Jul 2016]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased cell proliferation in the cornea without an increase in corneal thickness and increased microvessel branching in the middle levels of the retina. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Ntn4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL02052:Ntn4	APN	10	93707349	missense	probably damaging	1.00
IGL02212:Ntn4	APN	10	93644849	missense	possibly damaging	0.50
IGL02698:Ntn4	APN	10	93644659	missense	probably benign	0.19
IGL02752:Ntn4	APN	10	93710559	missense	possibly damaging	0.84
PIT4468001:Ntn4	UTSW	10	93644725	missense	probably damaging	0.99
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0131:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0132:Ntn4	UTSW	10	93644707	missense	possibly damaging	0.89
R0419:Ntn4	UTSW	10	93682429	missense	probably benign	0.04
R1304:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1306:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1307:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1308:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1619:Ntn4	UTSW	10	93644734	missense	probably damaging	1.00
R1645:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1664:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1695:Ntn4	UTSW	10	93733602	splice site	probably null
R1796:Ntn4	UTSW	10	93745771	missense	probably damaging	1.00
R1806:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1845:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1856:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1872:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1879:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1901:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1902:Ntn4	UTSW	10	93707372	missense	possibly damaging	0.93
R1925:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1926:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R1927:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2060:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2113:Ntn4	UTSW	10	93644839	missense	probably damaging	1.00
R2202:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2203:Ntn4	UTSW	10	93707353	missense	probably damaging	0.99
R2975:Ntn4	UTSW	10	93644891	missense	probably damaging	1.00
R4277:Ntn4	UTSW	10	93741210	missense	possibly damaging	0.95
R4805:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4806:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R4807:Ntn4	UTSW	10	93644500	missense	probably damaging	0.99
R5818:Ntn4	UTSW	10	93644764	missense	probably benign	0.40
R6048:Ntn4	UTSW	10	93707266	splice site	probably null
R6051:Ntn4	UTSW	10	93745795	missense	probably benign
R6346:Ntn4	UTSW	10	93644861	missense	probably damaging	1.00
R6752:Ntn4	UTSW	10	93734175	missense	probably benign
R7196:Ntn4	UTSW	10	93733714	missense	probably benign	0.01
R7240:Ntn4	UTSW	10	93745741	missense	probably damaging	0.99
R7365:Ntn4	UTSW	10	93644804	missense	probably damaging	1.00
R7374:Ntn4	UTSW	10	93682572	missense	probably benign
R7505:Ntn4	UTSW	10	93707284	missense	probably damaging	1.00
R7509:Ntn4	UTSW	10	93710568	missense	probably benign	0.01
R7957:Ntn4	UTSW	10	93644473	splice site	probably benign
R8092:Ntn4	UTSW	10	93741056	missense	probably damaging	0.97
R8202:Ntn4	UTSW	10	93644903	missense	possibly damaging	0.88
R8508:Ntn4	UTSW	10	93741104	missense	possibly damaging	0.48
R9008:Ntn4	UTSW	10	93733604	splice site	probably benign
R9010:Ntn4	UTSW	10	93644644	missense
R9115:Ntn4	UTSW	10	93733813	missense	probably benign
R9415:Ntn4	UTSW	10	93644626	missense	probably benign	0.00
RF045:Ntn4	UTSW	10	93710625	missense	possibly damaging	0.95
X0024:Ntn4	UTSW	10	93644971	missense	probably damaging	1.00
Z1176:Ntn4	UTSW	10	93741153	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- TCTTTCCTCAGCCAAAAGGTG -3'
(R):5'- AGCTTGAACTGCTCAGAGAC -3'

Sequencing Primer
(F):5'- GCACCTCAGAAACATGCTGTCTG -3'
(R):5'- GCTTGAACTGCTCAGAGACAAGAAC -3'

Posted On

2019-11-12