Incidental Mutation 'R7726:Or2y1d'
ID 595507
Institutional Source Beutler Lab
Gene Symbol Or2y1d
Ensembl Gene ENSMUSG00000107573
Gene Name olfactory receptor family 2 subfamily Y member 1D
Synonyms Olfr1389, MOR256-1, GA_x6K02T2QP88-6004387-6003452
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.214) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 49321254-49322326 bp(+) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) T to A at 49321727 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Stop codon at position 141 (C141*)
Ref Sequence ENSEMBL: ENSMUSP00000149032 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000203369] [ENSMUST00000216641] [ENSMUST00000217595]
AlphaFold Q8VGX0
Predicted Effect probably null
Transcript: ENSMUST00000203369
AA Change: C141*
SMART Domains Protein: ENSMUSP00000145461
Gene: ENSMUSG00000107573
AA Change: C141*

DomainStartEndE-ValueType
Pfam:7tm_4 30 306 1.9e-49 PFAM
Pfam:7tm_1 41 289 6.6e-20 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000216641
AA Change: C141*
Predicted Effect probably null
Transcript: ENSMUST00000217595
AA Change: C141*
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Or2y1d
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02377:Or2y1d APN 11 49,321,859 (GRCm39) missense probably damaging 1.00
IGL02468:Or2y1d APN 11 49,321,941 (GRCm39) missense probably damaging 0.99
IGL02607:Or2y1d APN 11 49,321,339 (GRCm39) missense probably damaging 1.00
IGL02721:Or2y1d APN 11 49,321,468 (GRCm39) nonsense probably null
IGL02812:Or2y1d APN 11 49,321,749 (GRCm39) missense probably damaging 1.00
IGL03086:Or2y1d APN 11 49,321,632 (GRCm39) missense probably benign 0.03
IGL03047:Or2y1d UTSW 11 49,321,794 (GRCm39) missense probably benign 0.10
PIT4531001:Or2y1d UTSW 11 49,321,753 (GRCm39) missense probably benign 0.01
R0413:Or2y1d UTSW 11 49,322,212 (GRCm39) missense possibly damaging 0.82
R0598:Or2y1d UTSW 11 49,322,230 (GRCm39) missense probably benign 0.00
R0653:Or2y1d UTSW 11 49,322,078 (GRCm39) nonsense probably null
R1654:Or2y1d UTSW 11 49,321,329 (GRCm39) missense probably benign 0.00
R2321:Or2y1d UTSW 11 49,322,107 (GRCm39) missense probably benign 0.00
R4995:Or2y1d UTSW 11 49,321,482 (GRCm39) missense probably damaging 1.00
R5670:Or2y1d UTSW 11 49,322,035 (GRCm39) missense probably damaging 1.00
R6127:Or2y1d UTSW 11 49,321,633 (GRCm39) missense probably damaging 0.97
R6327:Or2y1d UTSW 11 49,321,828 (GRCm39) missense probably damaging 1.00
R6935:Or2y1d UTSW 11 49,321,825 (GRCm39) missense probably damaging 0.97
R7923:Or2y1d UTSW 11 49,321,432 (GRCm39) missense probably benign 0.01
R8960:Or2y1d UTSW 11 49,321,543 (GRCm39) missense probably benign 0.19
Predicted Primers PCR Primer
(F):5'- CTGTGGGTTGGATAGGACCATC -3'
(R):5'- GTCCATAGGAGCCCAGAATC -3'

Sequencing Primer
(F):5'- TTGGATAGGACCATCAGCTATG -3'
(R):5'- GTTCGGGCCACAAACATCTTG -3'
Posted On 2019-11-12