Incidental Mutation 'R7726:Kcnh6'
ID595509
Institutional Source Beutler Lab
Gene Symbol Kcnh6
Ensembl Gene ENSMUSG00000001901
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 6
Synonymsm-erg2
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7726 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location106008124-106034549 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106017575 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 339 (V339A)
Ref Sequence ENSEMBL: ENSMUSP00000001965 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000106903] [ENSMUST00000145539]
Predicted Effect probably benign
Transcript: ENSMUST00000001965
AA Change: V339A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901
AA Change: V339A

DomainStartEndE-ValueType
Blast:PAS 13 87 2e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
Pfam:Ion_trans 256 523 6.8e-40 PFAM
Pfam:Ion_trans_2 445 517 2.6e-13 PFAM
cNMP 594 712 3.21e-23 SMART
coiled coil region 782 809 N/A INTRINSIC
low complexity region 901 912 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000106903
AA Change: V339A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901
AA Change: V339A

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 258 280 N/A INTRINSIC
Pfam:Ion_trans 302 420 6.2e-10 PFAM
Pfam:Ion_trans_2 395 464 2.6e-9 PFAM
cNMP 541 659 3.21e-23 SMART
coiled coil region 729 756 N/A INTRINSIC
low complexity region 848 859 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145539
AA Change: V339A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901
AA Change: V339A

DomainStartEndE-ValueType
Blast:PAS 13 87 3e-43 BLAST
PAC 93 135 4.06e-2 SMART
low complexity region 139 152 N/A INTRINSIC
low complexity region 158 173 N/A INTRINSIC
transmembrane domain 261 283 N/A INTRINSIC
Pfam:Ion_trans 302 511 1.4e-22 PFAM
Pfam:Ion_trans_2 442 517 2e-13 PFAM
cNMP 594 712 3.21e-23 SMART
low complexity region 764 775 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Kcnh6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00339:Kcnh6 APN 11 106019019 missense probably damaging 1.00
IGL01349:Kcnh6 APN 11 106023917 missense possibly damaging 0.82
IGL01529:Kcnh6 APN 11 106020696 missense probably benign 0.07
IGL01555:Kcnh6 APN 11 106017619 missense probably damaging 0.99
IGL01596:Kcnh6 APN 11 106026746 missense probably benign 0.02
IGL01808:Kcnh6 APN 11 106023927 splice site probably benign
IGL02001:Kcnh6 APN 11 106027549 splice site probably benign
IGL02131:Kcnh6 APN 11 106020175 missense probably damaging 1.00
IGL02254:Kcnh6 APN 11 106020707 missense probably damaging 1.00
IGL02413:Kcnh6 APN 11 106027634 missense possibly damaging 0.77
R0089:Kcnh6 UTSW 11 106009022 missense probably benign 0.31
R1914:Kcnh6 UTSW 11 106017444 nonsense probably null
R1915:Kcnh6 UTSW 11 106017444 nonsense probably null
R2265:Kcnh6 UTSW 11 106033817 missense probably benign
R2325:Kcnh6 UTSW 11 106033835 missense probably benign 0.00
R4449:Kcnh6 UTSW 11 106018936 missense probably damaging 0.99
R4548:Kcnh6 UTSW 11 106009049 missense probably damaging 1.00
R5095:Kcnh6 UTSW 11 106017254 missense possibly damaging 0.92
R5166:Kcnh6 UTSW 11 106020319 missense possibly damaging 0.67
R5358:Kcnh6 UTSW 11 106027591 missense possibly damaging 0.93
R5445:Kcnh6 UTSW 11 106023859 missense probably damaging 1.00
R5652:Kcnh6 UTSW 11 106008985 missense probably damaging 1.00
R5708:Kcnh6 UTSW 11 106020256 missense probably benign 0.04
R5742:Kcnh6 UTSW 11 106009142 missense probably benign 0.32
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6035:Kcnh6 UTSW 11 106019152 critical splice donor site probably null
R6150:Kcnh6 UTSW 11 106020731 missense possibly damaging 0.83
R6827:Kcnh6 UTSW 11 106009099 missense probably benign 0.05
R7172:Kcnh6 UTSW 11 106020274 missense possibly damaging 0.86
R7329:Kcnh6 UTSW 11 106017377 missense probably benign 0.29
R7359:Kcnh6 UTSW 11 106018963 missense possibly damaging 0.46
R7542:Kcnh6 UTSW 11 106014561 missense possibly damaging 0.68
R7571:Kcnh6 UTSW 11 106017416 missense probably benign 0.01
R7580:Kcnh6 UTSW 11 106017548 missense probably damaging 1.00
R7703:Kcnh6 UTSW 11 106023877 missense probably benign
R7837:Kcnh6 UTSW 11 106033810 missense probably benign 0.04
R7854:Kcnh6 UTSW 11 106017346 missense probably damaging 1.00
R7920:Kcnh6 UTSW 11 106033810 missense probably benign 0.04
R7937:Kcnh6 UTSW 11 106017346 missense probably damaging 1.00
X0065:Kcnh6 UTSW 11 106025795 missense probably benign
Z1088:Kcnh6 UTSW 11 106009048 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GACTGGCTCATCTTGCTCTTAG -3'
(R):5'- GCAGATGTTTGAAGCCCCTC -3'

Sequencing Primer
(F):5'- ATACAGCGGTCTTCACGC -3'
(R):5'- CTGCTTCCAATTGCTGTCTACATCAG -3'
Posted On2019-11-12