Mutagenetix > Incidental Mutations

Incidental Mutation 'R7726:Kcnh6'

595509

Institutional Source

Beutler Lab

Gene Symbol

Kcnh6

Ensembl Gene

ENSMUSG00000001901

Gene Name

potassium voltage-gated channel, subfamily H (eag-related), member 6

Synonyms

m-erg2

MMRRC Submission

Accession Numbers

Is this an essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

106008124-106034549 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to C at 106017575 bp

Zygosity

Heterozygous

Amino Acid Change

Valine to Alanine at position 339 (V339A)

Ref Sequence

ENSEMBL: ENSMUSP00000001965 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000001965] [ENSMUST00000106903] [ENSMUST00000145539]

Predicted Effect

probably benign
Transcript: ENSMUST00000001965
AA Change: V339A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000001965
Gene: ENSMUSG00000001901
AA Change: V339A

Domain	Start	End	E-Value	Type
Blast:PAS	13	87	2e-43	BLAST
PAC	93	135	4.06e-2	SMART
low complexity region	139	152	N/A	INTRINSIC
low complexity region	158	173	N/A	INTRINSIC
Pfam:Ion_trans	256	523	6.8e-40	PFAM
Pfam:Ion_trans_2	445	517	2.6e-13	PFAM
cNMP	594	712	3.21e-23	SMART
coiled coil region	782	809	N/A	INTRINSIC
low complexity region	901	912	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000106903
AA Change: V339A

PolyPhen 2 Score 0.038 (Sensitivity: 0.94; Specificity: 0.82)

SMART Domains

Protein: ENSMUSP00000102516
Gene: ENSMUSG00000001901
AA Change: V339A

Domain	Start	End	E-Value	Type
Blast:PAS	13	87	3e-43	BLAST
PAC	93	135	4.06e-2	SMART
low complexity region	139	152	N/A	INTRINSIC
low complexity region	158	173	N/A	INTRINSIC
transmembrane domain	258	280	N/A	INTRINSIC
Pfam:Ion_trans	302	420	6.2e-10	PFAM
Pfam:Ion_trans_2	395	464	2.6e-9	PFAM
cNMP	541	659	3.21e-23	SMART
coiled coil region	729	756	N/A	INTRINSIC
low complexity region	848	859	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000145539
AA Change: V339A

PolyPhen 2 Score 0.074 (Sensitivity: 0.93; Specificity: 0.85)

SMART Domains

Protein: ENSMUSP00000137675
Gene: ENSMUSG00000001901
AA Change: V339A

Domain	Start	End	E-Value	Type
Blast:PAS	13	87	3e-43	BLAST
PAC	93	135	4.06e-2	SMART
low complexity region	139	152	N/A	INTRINSIC
low complexity region	158	173	N/A	INTRINSIC
transmembrane domain	261	283	N/A	INTRINSIC
Pfam:Ion_trans	302	511	1.4e-22	PFAM
Pfam:Ion_trans_2	442	517	2e-13	PFAM
cNMP	594	712	3.21e-23	SMART
low complexity region	764	775	N/A	INTRINSIC

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Voltage-gated potassium (Kv) channels represent the most complex class of voltage-gated ion channels from both functional and structural standpoints. Their diverse functions include regulating neurotransmitter release, heart rate, insulin secretion, neuronal excitability, epithelial electrolyte transport, smooth muscle contraction, and cell volume. This gene encodes a member of the potassium channel, voltage-gated, subfamily H. This member is a pore-forming (alpha) subunit. Alternative splicing results in multiple transcript variants that encode different isoforms. [provided by RefSeq, Jul 2013]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Kcnh6

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00339:Kcnh6	APN	11	106019019	missense	probably damaging	1.00
IGL01349:Kcnh6	APN	11	106023917	missense	possibly damaging	0.82
IGL01529:Kcnh6	APN	11	106020696	missense	probably benign	0.07
IGL01555:Kcnh6	APN	11	106017619	missense	probably damaging	0.99
IGL01596:Kcnh6	APN	11	106026746	missense	probably benign	0.02
IGL01808:Kcnh6	APN	11	106023927	splice site	probably benign
IGL02001:Kcnh6	APN	11	106027549	splice site	probably benign
IGL02131:Kcnh6	APN	11	106020175	missense	probably damaging	1.00
IGL02254:Kcnh6	APN	11	106020707	missense	probably damaging	1.00
IGL02413:Kcnh6	APN	11	106027634	missense	possibly damaging	0.77
R0089:Kcnh6	UTSW	11	106009022	missense	probably benign	0.31
R1914:Kcnh6	UTSW	11	106017444	nonsense	probably null
R1915:Kcnh6	UTSW	11	106017444	nonsense	probably null
R2265:Kcnh6	UTSW	11	106033817	missense	probably benign
R2325:Kcnh6	UTSW	11	106033835	missense	probably benign	0.00
R4449:Kcnh6	UTSW	11	106018936	missense	probably damaging	0.99
R4548:Kcnh6	UTSW	11	106009049	missense	probably damaging	1.00
R5095:Kcnh6	UTSW	11	106017254	missense	possibly damaging	0.92
R5166:Kcnh6	UTSW	11	106020319	missense	possibly damaging	0.67
R5358:Kcnh6	UTSW	11	106027591	missense	possibly damaging	0.93
R5445:Kcnh6	UTSW	11	106023859	missense	probably damaging	1.00
R5652:Kcnh6	UTSW	11	106008985	missense	probably damaging	1.00
R5708:Kcnh6	UTSW	11	106020256	missense	probably benign	0.04
R5742:Kcnh6	UTSW	11	106009142	missense	probably benign	0.32
R6035:Kcnh6	UTSW	11	106019152	critical splice donor site	probably null
R6035:Kcnh6	UTSW	11	106019152	critical splice donor site	probably null
R6150:Kcnh6	UTSW	11	106020731	missense	possibly damaging	0.83
R6827:Kcnh6	UTSW	11	106009099	missense	probably benign	0.05
R7172:Kcnh6	UTSW	11	106020274	missense	possibly damaging	0.86
R7329:Kcnh6	UTSW	11	106017377	missense	probably benign	0.29
R7359:Kcnh6	UTSW	11	106018963	missense	possibly damaging	0.46
R7542:Kcnh6	UTSW	11	106014561	missense	possibly damaging	0.68
R7571:Kcnh6	UTSW	11	106017416	missense	probably benign	0.01
R7580:Kcnh6	UTSW	11	106017548	missense	probably damaging	1.00
R7703:Kcnh6	UTSW	11	106023877	missense	probably benign
R7837:Kcnh6	UTSW	11	106033810	missense	probably benign	0.04
R7854:Kcnh6	UTSW	11	106017346	missense	probably damaging	1.00
R7971:Kcnh6	UTSW	11	106017527	missense	probably damaging	1.00
R8218:Kcnh6	UTSW	11	106017374	missense	possibly damaging	0.88
R8274:Kcnh6	UTSW	11	106020161	missense	probably damaging	1.00
R8351:Kcnh6	UTSW	11	106020236	missense	probably damaging	0.99
X0065:Kcnh6	UTSW	11	106025795	missense	probably benign
Z1088:Kcnh6	UTSW	11	106009048	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GACTGGCTCATCTTGCTCTTAG -3'
(R):5'- GCAGATGTTTGAAGCCCCTC -3'

Sequencing Primer
(F):5'- ATACAGCGGTCTTCACGC -3'
(R):5'- CTGCTTCCAATTGCTGTCTACATCAG -3'

Posted On

2019-11-12