Mutagenetix > Incidental Mutation

Incidental Mutation 'R7726:Brf1'

595510

Institutional Source

Beutler Lab

Gene Symbol

Brf1

Ensembl Gene

ENSMUSG00000011158

Gene Name

BRF1, RNA polymerase III transcription initiation factor 90 kDa subunit

Synonyms

GTF3B, 2510002F24Rik, TAFIII90, TFIIIB90, TAF3C

MMRRC Submission

045782-MU

Accession Numbers

Genbank: NM_028193; MGI: 1919558

Essential gene?

Probably essential (E-score: 0.972) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

112960085-113000704 bp(-) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

T to G at 112964245 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Threonine at position 438 (K438T)

Ref Sequence

ENSEMBL: ENSMUSP00000011302 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000011302]

AlphaFold

no structure available at present

Predicted Effect

probably benign
Transcript: ENSMUST00000011302
AA Change: K438T

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000011302
Gene: ENSMUSG00000011158
AA Change: K438T

Domain	Start	End	E-Value	Type
Pfam:TF_Zn_Ribbon	4	46	4.3e-17	PFAM
CYCLIN	91	172	1.93e-12	SMART
CYCLIN	185	269	1.22e-9	SMART
coiled coil region	298	334	N/A	INTRINSIC
low complexity region	362	374	N/A	INTRINSIC
low complexity region	431	444	N/A	INTRINSIC
Pfam:BRF1	452	545	3.3e-29	PFAM
low complexity region	638	650	N/A	INTRINSIC
low complexity region	662	675	N/A	INTRINSIC

Meta Mutation Damage Score

0.0673

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the three subunits of the RNA polymerase III transcription factor complex. This complex plays a central role in transcription initiation by RNA polymerase III on genes encoding tRNA, 5S rRNA, and other small structural RNAs. The gene product belongs to the TF2B family. Several alternatively spliced variants encoding different isoforms, that function at different promoters transcribed by RNA polymerase III, have been identified. [provided by RefSeq, Jun 2011]

Allele List at MGI

All alleles(3) : Gene trapped(3)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Brf1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00928:Brf1	APN	12	112963600	splice site	probably benign
IGL01609:Brf1	APN	12	112963591	missense	probably damaging	1.00
IGL01610:Brf1	APN	12	112988083	missense	probably benign
IGL01622:Brf1	APN	12	112961175	missense	probably benign	0.02
IGL01623:Brf1	APN	12	112961175	missense	probably benign	0.02
IGL01791:Brf1	APN	12	112962475	missense	probably benign	0.00
IGL02037:Brf1	APN	12	112993062	critical splice donor site	probably null
IGL02227:Brf1	APN	12	112961774	missense	probably damaging	1.00
R0106:Brf1	UTSW	12	112973463	unclassified	probably benign
R0106:Brf1	UTSW	12	112973463	unclassified	probably benign
R0138:Brf1	UTSW	12	112961139	missense	probably damaging	0.99
R1345:Brf1	UTSW	12	112961108	critical splice donor site	probably null
R1370:Brf1	UTSW	12	112961108	critical splice donor site	probably null
R1927:Brf1	UTSW	12	113000344	missense	possibly damaging	0.95
R2423:Brf1	UTSW	12	113000199	missense	probably benign	0.17
R3608:Brf1	UTSW	12	112961274	missense	probably benign	0.00
R3703:Brf1	UTSW	12	112969371	splice site	probably null
R4033:Brf1	UTSW	12	112979732	missense	probably damaging	1.00
R4817:Brf1	UTSW	12	112972301	missense	probably damaging	0.99
R4897:Brf1	UTSW	12	112965887	missense	probably benign	0.05
R4985:Brf1	UTSW	12	112969370	splice site	probably null
R5092:Brf1	UTSW	12	112979732	missense	probably damaging	1.00
R7138:Brf1	UTSW	12	112970215	missense	probably damaging	1.00
R7187:Brf1	UTSW	12	112960325	missense	unknown
R7970:Brf1	UTSW	12	112964200	missense	probably damaging	1.00
R8719:Brf1	UTSW	12	112979684	critical splice donor site	probably benign
R8897:Brf1	UTSW	12	112987969	missense	probably damaging	1.00
R8967:Brf1	UTSW	12	112973619	missense	probably damaging	1.00
R9109:Brf1	UTSW	12	112963391	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GCACTATGCCTTGAGAGCAC -3'
(R):5'- GGGACTTGGTAATCTGAGCATAG -3'

Sequencing Primer
(F):5'- CACTCATTTGTTAGGGATGTCTAAG -3'
(R):5'- CTTGGTAATCTGAGCATAGGCAGC -3'

Posted On

2019-11-12