Incidental Mutation 'R7726:Tbce'
List |< first << previous [record 58 of 65] next >> last >|
ID595512
Institutional Source Beutler Lab
Gene Symbol Tbce
Ensembl Gene ENSMUSG00000039233
Gene Nametubulin-specific chaperone E
Synonyms
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7726 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location13997949-14039638 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 14029290 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 29 (V29A)
Ref Sequence ENSEMBL: ENSMUSP00000047880 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039894] [ENSMUST00000159893] [ENSMUST00000162326]
PDB Structure
Solution structure of the C-terminal ubiquitin-like domain of mouse tubulin-specific chaperone e [SOLUTION NMR]
Predicted Effect probably damaging
Transcript: ENSMUST00000039894
AA Change: V29A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000047880
Gene: ENSMUSG00000039233
AA Change: V29A

DomainStartEndE-ValueType
CAP_GLY 10 76 5.23e-32 SMART
SCOP:d1fqva2 117 345 4e-20 SMART
low complexity region 347 360 N/A INTRINSIC
Pfam:Ubiquitin_2 442 523 1.1e-7 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000159893
AA Change: V29A
SMART Domains Protein: ENSMUSP00000125244
Gene: ENSMUSG00000039233
AA Change: V29A

DomainStartEndE-ValueType
SCOP:d1lpla_ 9 35 3e-5 SMART
Blast:CAP_GLY 10 34 2e-10 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000162326
AA Change: V29A

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000125613
Gene: ENSMUSG00000039233
AA Change: V29A

DomainStartEndE-ValueType
CAP_GLY 10 76 5.23e-32 SMART
SCOP:d1fqva2 117 345 4e-21 SMART
low complexity region 347 360 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a tubulin binding cofactor that participates in microtubule dynamics. A mouse model of progressive motor neuropathy (pmn) was discovered to harbor a single amino acid deletion in this gene. Mice that are homozygous for pmn allele exhibit progressive atrophy and premature death due to respiratory failure. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Feb 2015]
PHENOTYPE: Homozygotes for a spontaneous mutation exhibit progressive caudal-cranial motor neuron degeneration, beginning around 3 weeks and culminating in death due to respiratory paralysis by 7 weeks. The sciatic and phrenic nerves are especially affected. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Tbce
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01291:Tbce APN 13 14009740 splice site probably benign
IGL01405:Tbce APN 13 14003695 missense probably damaging 1.00
IGL03142:Tbce APN 13 14019864 missense possibly damaging 0.90
R0362:Tbce UTSW 13 13998162 missense probably benign 0.12
R1736:Tbce UTSW 13 14009642 missense possibly damaging 0.64
R1845:Tbce UTSW 13 14019709 missense probably benign 0.22
R4445:Tbce UTSW 13 13998395 missense possibly damaging 0.82
R4803:Tbce UTSW 13 14019861 missense probably damaging 1.00
R4860:Tbce UTSW 13 14019795 missense probably damaging 0.97
R4860:Tbce UTSW 13 14019795 missense probably damaging 0.97
R4862:Tbce UTSW 13 13998419 missense possibly damaging 0.94
R5096:Tbce UTSW 13 14029405 splice site probably benign
R5391:Tbce UTSW 13 14005965 missense probably damaging 0.99
R6050:Tbce UTSW 13 13998434 missense possibly damaging 0.82
R6179:Tbce UTSW 13 14019777 missense probably benign
R6645:Tbce UTSW 13 14005229 missense probably benign 0.04
R7062:Tbce UTSW 13 14019795 missense possibly damaging 0.89
R7222:Tbce UTSW 13 13998150 missense probably damaging 1.00
R7572:Tbce UTSW 13 14010587 missense probably benign
R7587:Tbce UTSW 13 14019742 missense probably damaging 1.00
R7747:Tbce UTSW 13 14006478 missense possibly damaging 0.93
Predicted Primers PCR Primer
(F):5'- ATGTGTCTGCAAGTTGGCTG -3'
(R):5'- TCATTGTTCTTTAGTATGTGTGTACAC -3'

Sequencing Primer
(F):5'- CTTTATTGGAGACCGTGCCGC -3'
(R):5'- ACATGGAACTCACCTGTTGG -3'
Posted On2019-11-12