Incidental Mutation 'R7726:Zfp874b'
ID 595513
Institutional Source Beutler Lab
Gene Symbol Zfp874b
Ensembl Gene ENSMUSG00000059839
Gene Name zinc finger protein 874b
Synonyms 9630025I21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.073) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 67471513-67484258 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to C at 67473856 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 441 (D441G)
Ref Sequence ENSEMBL: ENSMUSP00000019572 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000019572] [ENSMUST00000223868]
AlphaFold Q7M6X2
Predicted Effect probably benign
Transcript: ENSMUST00000019572
AA Change: D441G

PolyPhen 2 Score 0.007 (Sensitivity: 0.96; Specificity: 0.75)
SMART Domains Protein: ENSMUSP00000019572
Gene: ENSMUSG00000059839
AA Change: D441G

DomainStartEndE-ValueType
KRAB 5 65 4.48e-26 SMART
ZnF_C2H2 136 158 5.9e-3 SMART
ZnF_C2H2 164 186 3.16e-3 SMART
ZnF_C2H2 192 214 6.78e-3 SMART
ZnF_C2H2 220 242 2.4e-3 SMART
ZnF_C2H2 248 268 1.88e2 SMART
ZnF_C2H2 276 298 6.42e-4 SMART
ZnF_C2H2 304 326 2.12e-4 SMART
ZnF_C2H2 332 354 1.28e-3 SMART
ZnF_C2H2 360 382 8.47e-4 SMART
ZnF_C2H2 388 410 1.79e-2 SMART
ZnF_C2H2 416 438 1.47e-3 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000223868
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Zfp874b
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02172:Zfp874b APN 13 67474016 missense probably damaging 1.00
R0432:Zfp874b UTSW 13 67481836 missense probably damaging 1.00
R0653:Zfp874b UTSW 13 67474933 missense possibly damaging 0.69
R0727:Zfp874b UTSW 13 67474712 missense probably damaging 1.00
R1475:Zfp874b UTSW 13 67474092 splice site probably null
R1726:Zfp874b UTSW 13 67474720 missense probably damaging 1.00
R5484:Zfp874b UTSW 13 67481254 missense possibly damaging 0.76
R6386:Zfp874b UTSW 13 67474843 missense possibly damaging 0.70
R7029:Zfp874b UTSW 13 67474273 missense probably damaging 0.98
R7150:Zfp874b UTSW 13 67474503 nonsense probably null
R7778:Zfp874b UTSW 13 67473974 missense probably benign 0.03
R7824:Zfp874b UTSW 13 67473974 missense probably benign 0.03
R7918:Zfp874b UTSW 13 67474160 missense possibly damaging 0.74
R7939:Zfp874b UTSW 13 67474503 nonsense probably null
R8053:Zfp874b UTSW 13 67474098 missense probably damaging 0.96
R8881:Zfp874b UTSW 13 67474022 missense probably damaging 0.99
X0028:Zfp874b UTSW 13 67474060 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- TGGAGGTTTTCTCTTCAGTATGAAC -3'
(R):5'- AGTGTCAAGAATGTGGCAAATC -3'

Sequencing Primer
(F):5'- CAGCCTTGTGTCTCCTAAGAAATGAG -3'
(R):5'- CTCCCCATGAGTGTGTAGAATGC -3'
Posted On 2019-11-12