Mutagenetix > Incidental Mutation

Incidental Mutation 'R7726:Nup155'

595517

Institutional Source

Beutler Lab

Gene Symbol

Nup155

Ensembl Gene

ENSMUSG00000022142

Gene Name

nucleoporin 155

Synonyms

D930027M19Rik

MMRRC Submission

045782-MU

Accession Numbers

Genbank: NM_133227

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

8109273-8161247 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 8122139 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 393 (P393S)

Ref Sequence

ENSEMBL: ENSMUSP00000128819 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000163765] [ENSMUST00000230017]

AlphaFold

Q99P88

Predicted Effect

probably damaging
Transcript: ENSMUST00000163765
AA Change: P393S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000128819
Gene: ENSMUSG00000022142
AA Change: P393S

Domain	Start	End	E-Value	Type
low complexity region	7	18	N/A	INTRINSIC
Pfam:Nucleoporin_N	77	510	3.5e-105	PFAM
low complexity region	600	619	N/A	INTRINSIC
Pfam:Nucleoporin_C	678	1221	3.6e-23	PFAM

Predicted Effect

probably damaging
Transcript: ENSMUST00000230017
AA Change: P393S

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Nucleoporins are proteins that play an important role in the assembly and functioning of the nuclear pore complex (NPC) which regulates the movement of macromolecules across the nuclear envelope (NE). The protein encoded by this gene plays a role in the fusion of NE vesicles and formation of the double membrane NE. The protein may also be involved in cardiac physiology and may be associated with the pathogenesis of atrial fibrillation. Alternative splicing results in multiple transcript variants of this gene. A pseudogene associated with this gene is located on chromosome 6. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a gene trap allele die prior to E8.5. Mice homozygous for a gene trap allele exhibit atria fibrillation associated with shortened action potential duration. [provided by MGI curators]

Allele List at MGI

All alleles(18) : Gene trapped(18)

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Add3	C	G	19: 53,239,461	L526V	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Nup155

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00228:Nup155	APN	15	8121455	splice site	probably benign
IGL00426:Nup155	APN	15	8156794	makesense	probably null
IGL00765:Nup155	APN	15	8153228	missense	probably benign	0.16
IGL00936:Nup155	APN	15	8128405	splice site	probably benign
IGL01124:Nup155	APN	15	8153679	missense	probably damaging	0.97
IGL01739:Nup155	APN	15	8135788	missense	probably benign	0.01
IGL02013:Nup155	APN	15	8113648	missense	possibly damaging	0.61
IGL02066:Nup155	APN	15	8157766	unclassified	probably benign
IGL02231:Nup155	APN	15	8144064	missense	probably damaging	1.00
IGL02246:Nup155	APN	15	8143002	missense	probably benign
IGL02289:Nup155	APN	15	8131493	missense	probably damaging	1.00
IGL02608:Nup155	APN	15	8109471	missense	probably benign
IGL02749:Nup155	APN	15	8134076	missense	probably damaging	1.00
IGL02813:Nup155	APN	15	8130121	splice site	probably benign
IGL03102:Nup155	APN	15	8147284	missense	probably benign	0.00
H8930:Nup155	UTSW	15	8157658	missense	possibly damaging	0.50
IGL02835:Nup155	UTSW	15	8143130	missense	probably damaging	1.00
R0314:Nup155	UTSW	15	8147252	missense	probably benign	0.00
R0365:Nup155	UTSW	15	8131543	missense	probably damaging	1.00
R0586:Nup155	UTSW	15	8130232	missense	probably benign	0.39
R0764:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R0839:Nup155	UTSW	15	8145587	missense	possibly damaging	0.48
R0844:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1066:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1067:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1085:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1137:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1162:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1166:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1202:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1203:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1219:Nup155	UTSW	15	8117338	missense	possibly damaging	0.80
R1385:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1421:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1448:Nup155	UTSW	15	8112406	missense	probably benign	0.44
R1611:Nup155	UTSW	15	8130160	missense	probably damaging	1.00
R1836:Nup155	UTSW	15	8154980	missense	possibly damaging	0.79
R1863:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1866:Nup155	UTSW	15	8115526	missense	probably damaging	1.00
R1894:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R1976:Nup155	UTSW	15	8135827	missense	probably benign	0.01
R2024:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2026:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2027:Nup155	UTSW	15	8157760	missense	probably damaging	1.00
R2077:Nup155	UTSW	15	8143026	missense	probably damaging	1.00
R2111:Nup155	UTSW	15	8121467	missense	probably benign	0.45
R2921:Nup155	UTSW	15	8153641	missense	probably damaging	1.00
R2936:Nup155	UTSW	15	8143049	missense	possibly damaging	0.89
R3108:Nup155	UTSW	15	8117306	missense	probably null	1.00
R3161:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3162:Nup155	UTSW	15	8148383	missense	possibly damaging	0.56
R3522:Nup155	UTSW	15	8156678	splice site	probably benign
R4423:Nup155	UTSW	15	8121464	missense	probably damaging	0.99
R4451:Nup155	UTSW	15	8150882	missense	probably benign	0.02
R4498:Nup155	UTSW	15	8153673	missense	possibly damaging	0.88
R4780:Nup155	UTSW	15	8157703	missense	probably benign	0.00
R4822:Nup155	UTSW	15	8128526	missense	possibly damaging	0.49
R5013:Nup155	UTSW	15	8124238	missense	probably benign	0.00
R5064:Nup155	UTSW	15	8135870	missense	probably damaging	1.00
R5172:Nup155	UTSW	15	8109542	missense	probably benign	0.06
R5406:Nup155	UTSW	15	8153638	critical splice acceptor site	probably null
R5551:Nup155	UTSW	15	8148333	missense	probably benign	0.09
R5588:Nup155	UTSW	15	8119253	critical splice donor site	probably null
R5977:Nup155	UTSW	15	8130237	critical splice donor site	probably null
R6035:Nup155	UTSW	15	8144093	missense	probably benign
R6035:Nup155	UTSW	15	8144093	missense	probably benign
R6036:Nup155	UTSW	15	8128411	missense	probably benign	0.16
R6036:Nup155	UTSW	15	8128411	missense	probably benign	0.16
R6085:Nup155	UTSW	15	8148358	missense	probably damaging	0.98
R6188:Nup155	UTSW	15	8109575	missense	probably damaging	1.00
R6232:Nup155	UTSW	15	8109479	missense	probably benign	0.02
R6257:Nup155	UTSW	15	8150798	nonsense	probably null
R6262:Nup155	UTSW	15	8156741	missense	probably benign	0.03
R6267:Nup155	UTSW	15	8153155	missense	probably damaging	1.00
R6296:Nup155	UTSW	15	8153155	missense	probably damaging	1.00
R6299:Nup155	UTSW	15	8128438	missense	possibly damaging	0.88
R6303:Nup155	UTSW	15	8118042	missense	probably damaging	1.00
R6304:Nup155	UTSW	15	8118042	missense	probably damaging	1.00
R6763:Nup155	UTSW	15	8135895	nonsense	probably null
R6958:Nup155	UTSW	15	8147154	missense	probably damaging	1.00
R7088:Nup155	UTSW	15	8156693	missense	probably benign	0.11
R7313:Nup155	UTSW	15	8154922	missense	probably damaging	0.96
R7451:Nup155	UTSW	15	8145607	nonsense	probably null
R7560:Nup155	UTSW	15	8155047	missense	probably benign	0.39
R7633:Nup155	UTSW	15	8109453	missense	probably damaging	0.99
R7670:Nup155	UTSW	15	8153696	missense	probably damaging	0.99
R7752:Nup155	UTSW	15	8116442	missense	possibly damaging	0.53
R7889:Nup155	UTSW	15	8121507	missense	probably damaging	0.98
R7899:Nup155	UTSW	15	8119179	missense	probably damaging	1.00
R7901:Nup155	UTSW	15	8116442	missense	possibly damaging	0.53
R8429:Nup155	UTSW	15	8112420	missense	probably damaging	0.96
R8467:Nup155	UTSW	15	8121531	missense	probably benign	0.00
R8507:Nup155	UTSW	15	8147560	nonsense	probably null
R8860:Nup155	UTSW	15	8130156	missense	possibly damaging	0.96
R8994:Nup155	UTSW	15	8143161	critical splice donor site	probably null
R9046:Nup155	UTSW	15	8128435	frame shift	probably null
R9086:Nup155	UTSW	15	8148346	missense	possibly damaging	0.84
R9500:Nup155	UTSW	15	8112316	missense	probably damaging	1.00
RF003:Nup155	UTSW	15	8119176	critical splice acceptor site	probably benign
RF048:Nup155	UTSW	15	8119176	critical splice acceptor site	probably benign
Z1177:Nup155	UTSW	15	8120489	missense	probably benign	0.23

Predicted Primers

PCR Primer
(F):5'- TCTGGACATCTTCTAGAACGTGG -3'
(R):5'- AGTTTAGACCAATCACGTAGGAAG -3'

Sequencing Primer
(F):5'- ATCTTCTAGAACGTGGTTTAATTGGC -3'
(R):5'- AGTTCAAGCATAGCCTGGTC -3'

Posted On

2019-11-12