Incidental Mutation 'R7726:Cpne8'
ID 595520
Institutional Source Beutler Lab
Gene Symbol Cpne8
Ensembl Gene ENSMUSG00000052560
Gene Name copine VIII
Synonyms 1200003E11Rik, 1500031E20Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.167) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 15
Chromosomal Location 90487482-90679432 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 90501418 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Lysine at position 469 (I469K)
Ref Sequence ENSEMBL: ENSMUSP00000067774 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000064391] [ENSMUST00000088649]
AlphaFold Q9DC53
Predicted Effect possibly damaging
Transcript: ENSMUST00000064391
AA Change: I469K

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000067774
Gene: ENSMUSG00000052560
AA Change: I469K

DomainStartEndE-ValueType
C2 37 145 9.76e-10 SMART
C2 170 277 1.06e-10 SMART
low complexity region 284 291 N/A INTRINSIC
VWA 320 518 1.34e-9 SMART
low complexity region 559 569 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000088649
SMART Domains Protein: ENSMUSP00000086024
Gene: ENSMUSG00000052560

DomainStartEndE-ValueType
C2 37 139 8.78e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a member of the copine family of highly conserved, calcium-dependent phospholipid binding proteins. The encoded protein has two characteristic C2 domains and a VWFA domain and may play a role in membrane trafficking. A related pseudogene is found on chromosome 8. Alternatively spliced transcript variants encoding different isoforms have been described. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Cpne8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00434:Cpne8 APN 15 90497058 splice site probably benign
IGL00545:Cpne8 APN 15 90540259 missense probably benign
IGL00951:Cpne8 APN 15 90601893 intron probably benign
IGL01069:Cpne8 APN 15 90615110 critical splice donor site probably null
IGL01294:Cpne8 APN 15 90501445 missense probably damaging 0.96
IGL01720:Cpne8 APN 15 90501500 missense probably benign 0.01
IGL01843:Cpne8 APN 15 90569497 missense probably benign 0.17
PIT4431001:Cpne8 UTSW 15 90551975 missense probably damaging 0.98
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0016:Cpne8 UTSW 15 90501405 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0032:Cpne8 UTSW 15 90569568 splice site probably benign
R0096:Cpne8 UTSW 15 90499915 missense probably benign 0.24
R0545:Cpne8 UTSW 15 90497075 missense probably damaging 1.00
R0637:Cpne8 UTSW 15 90648621 missense probably damaging 1.00
R0834:Cpne8 UTSW 15 90540259 missense probably benign
R0894:Cpne8 UTSW 15 90649271 missense probably damaging 0.97
R1568:Cpne8 UTSW 15 90619642 missense probably damaging 0.98
R1629:Cpne8 UTSW 15 90571972 missense probably benign 0.03
R1747:Cpne8 UTSW 15 90584915 missense probably benign 0.00
R1761:Cpne8 UTSW 15 90648618 missense probably damaging 1.00
R1884:Cpne8 UTSW 15 90648628 splice site probably benign
R2357:Cpne8 UTSW 15 90619674 missense probably damaging 0.99
R2434:Cpne8 UTSW 15 90509511 missense probably benign 0.07
R4043:Cpne8 UTSW 15 90572001 missense probably damaging 1.00
R4875:Cpne8 UTSW 15 90648568 splice site probably benign
R4969:Cpne8 UTSW 15 90619726 missense probably damaging 1.00
R4981:Cpne8 UTSW 15 90679235 missense probably benign 0.05
R5086:Cpne8 UTSW 15 90648568 splice site probably benign
R5154:Cpne8 UTSW 15 90499918 missense probably benign 0.10
R5199:Cpne8 UTSW 15 90648609 missense probably benign 0.10
R5424:Cpne8 UTSW 15 90516057 missense probably benign 0.00
R5528:Cpne8 UTSW 15 90619690 missense possibly damaging 0.95
R5946:Cpne8 UTSW 15 90488988 makesense probably null
R6158:Cpne8 UTSW 15 90571988 missense probably damaging 1.00
R6977:Cpne8 UTSW 15 90497091 missense probably benign 0.10
R7486:Cpne8 UTSW 15 90515906 critical splice donor site probably null
R7522:Cpne8 UTSW 15 90601819 missense probably benign 0.09
R7684:Cpne8 UTSW 15 90649247 missense probably damaging 1.00
R7799:Cpne8 UTSW 15 90540247 missense probably damaging 1.00
R8162:Cpne8 UTSW 15 90619678 missense probably benign
R8353:Cpne8 UTSW 15 90541293 missense possibly damaging 0.80
R8405:Cpne8 UTSW 15 90572032 missense possibly damaging 0.67
R8842:Cpne8 UTSW 15 90572015 missense probably benign
R8856:Cpne8 UTSW 15 90601841 missense probably benign 0.06
R8922:Cpne8 UTSW 15 90572010 missense probably damaging 1.00
R9058:Cpne8 UTSW 15 90497073 missense probably damaging 1.00
R9550:Cpne8 UTSW 15 90569557 missense probably benign 0.06
Predicted Primers PCR Primer
(F):5'- CATGCAGCACTGGGATAAATG -3'
(R):5'- TGTATATCAGAGGCTTCCGGCG -3'

Sequencing Primer
(F):5'- CACTGGGATAAATGTGGGACTGTTTC -3'
(R):5'- CATTAGTAGAATGCTGGTTTGGCC -3'
Posted On 2019-11-12