Incidental Mutation 'R7726:Prss33'
ID 595522
Institutional Source Beutler Lab
Gene Symbol Prss33
Ensembl Gene ENSMUSG00000049620
Gene Name serine protease 33
Synonyms mT6, tryptase-6, Eos
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.064) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 17
Chromosomal Location 24052321-24055030 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 24053203 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Arginine at position 213 (C213R)
Ref Sequence ENSEMBL: ENSMUSP00000059491 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000024926] [ENSMUST00000059906] [ENSMUST00000115444] [ENSMUST00000122936]
AlphaFold Q80WM7
Predicted Effect probably benign
Transcript: ENSMUST00000024926
SMART Domains Protein: ENSMUSP00000024926
Gene: ENSMUSG00000024114

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Tryp_SPc 52 289 2.48e-79 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000059906
AA Change: C213R

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000059491
Gene: ENSMUSG00000049620
AA Change: C213R

DomainStartEndE-ValueType
signal peptide 1 24 N/A INTRINSIC
Tryp_SPc 33 271 9.03e-91 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000115444
SMART Domains Protein: ENSMUSP00000111104
Gene: ENSMUSG00000049620

DomainStartEndE-ValueType
Tryp_SPc 15 253 4.5e-93 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000122936
SMART Domains Protein: ENSMUSP00000120141
Gene: ENSMUSG00000024114

DomainStartEndE-ValueType
Tryp_SPc 12 249 2.48e-79 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Prss33
AlleleSourceChrCoordTypePredicted EffectPPH Score
Scissorhands UTSW 17 24,053,676 (GRCm39) missense probably benign 0.00
R0506:Prss33 UTSW 17 24,054,079 (GRCm39) missense probably benign 0.00
R1201:Prss33 UTSW 17 24,054,084 (GRCm39) nonsense probably null
R1478:Prss33 UTSW 17 24,054,072 (GRCm39) missense probably damaging 1.00
R1652:Prss33 UTSW 17 24,054,116 (GRCm39) missense probably benign 0.10
R1652:Prss33 UTSW 17 24,054,115 (GRCm39) missense probably benign 0.00
R1662:Prss33 UTSW 17 24,053,785 (GRCm39) splice site probably null
R1994:Prss33 UTSW 17 24,053,172 (GRCm39) missense probably damaging 0.99
R2151:Prss33 UTSW 17 24,053,817 (GRCm39) missense probably damaging 1.00
R2153:Prss33 UTSW 17 24,053,817 (GRCm39) missense probably damaging 1.00
R2154:Prss33 UTSW 17 24,053,817 (GRCm39) missense probably damaging 1.00
R5002:Prss33 UTSW 17 24,054,332 (GRCm39) unclassified probably benign
R6648:Prss33 UTSW 17 24,053,676 (GRCm39) missense probably benign 0.00
R6662:Prss33 UTSW 17 24,052,934 (GRCm39) missense probably damaging 0.99
R6801:Prss33 UTSW 17 24,053,813 (GRCm39) missense possibly damaging 0.88
R8335:Prss33 UTSW 17 24,053,569 (GRCm39) critical splice donor site probably null
R8413:Prss33 UTSW 17 24,052,930 (GRCm39) missense probably damaging 1.00
R8678:Prss33 UTSW 17 24,053,723 (GRCm39) missense probably benign 0.11
R8775:Prss33 UTSW 17 24,052,885 (GRCm39) missense possibly damaging 0.65
R8775-TAIL:Prss33 UTSW 17 24,052,885 (GRCm39) missense possibly damaging 0.65
R9151:Prss33 UTSW 17 24,052,966 (GRCm39) missense probably benign 0.00
R9332:Prss33 UTSW 17 24,053,723 (GRCm39) missense probably damaging 0.99
R9624:Prss33 UTSW 17 24,054,656 (GRCm39) missense probably benign 0.07
Predicted Primers PCR Primer
(F):5'- TTCAAGGCCACTTTCCTAAGCC -3'
(R):5'- CTGGGTTGCAAATCAGACCC -3'

Sequencing Primer
(F):5'- GCCACTTTCCTAAGCCCAGTTC -3'
(R):5'- GTTGCAAATCAGACCCTCCCG -3'
Posted On 2019-11-12