Incidental Mutation 'R7726:Stub1'
ID595523
Institutional Source Beutler Lab
Gene Symbol Stub1
Ensembl Gene ENSMUSG00000039615
Gene NameSTIP1 homology and U-Box containing protein 1
Synonyms0610033N24Rik, 2210017D18Rik, 2310040B03Rik, CHIP
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.724) question?
Stock #R7726 (G1)
Quality Score225.009
Status Not validated
Chromosome17
Chromosomal Location25830636-25833361 bp(-) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) A to T at 25831132 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Stop codon at position 253 (Y253*)
Ref Sequence ENSEMBL: ENSMUSP00000040431 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026831] [ENSMUST00000026832] [ENSMUST00000026833] [ENSMUST00000044911] [ENSMUST00000123582] [ENSMUST00000133595] [ENSMUST00000183929] [ENSMUST00000184865]
PDB Structure
CRYSTAL STRUCTURE OF THE CHIP U-BOX E3 UBIQUITIN LIGASE [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CHIP-UBC13-UEV1A COMPLEX [X-RAY DIFFRACTION]
Crystal structure of TPR domain of CHIP complexed with pseudophosphorylated Smad1 peptide [X-RAY DIFFRACTION]
Crystal structure of the TPR domain of CHIP complexed with Hsp70-C peptide [X-RAY DIFFRACTION]
Crystal structure of the TPR domain of CHIP complexed with phosphorylated Smad1 peptide [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000026831
SMART Domains Protein: ENSMUSP00000026831
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 5e-7 SMART
Blast:EFh 43 71 9e-11 BLAST
transmembrane domain 129 151 N/A INTRINSIC
Pfam:Rhomboid 174 331 6.7e-36 PFAM
transmembrane domain 339 361 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000026832
SMART Domains Protein: ENSMUSP00000026832
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
JmjC 140 271 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000026833
SMART Domains Protein: ENSMUSP00000026833
Gene: ENSMUSG00000025737

DomainStartEndE-ValueType
Blast:WD40 19 53 6e-8 BLAST
WD40 68 103 2.13e1 SMART
WD40 109 149 5.77e-5 SMART
WD40 152 192 4.48e-2 SMART
WD40 196 236 1.48e-11 SMART
WD40 244 282 1.66e0 SMART
WD40 286 327 2.48e0 SMART
low complexity region 605 623 N/A INTRINSIC
Blast:RING 743 780 2e-7 BLAST
Predicted Effect probably null
Transcript: ENSMUST00000044911
AA Change: Y253*
SMART Domains Protein: ENSMUSP00000040431
Gene: ENSMUSG00000039615
AA Change: Y253*

DomainStartEndE-ValueType
low complexity region 9 19 N/A INTRINSIC
TPR 27 60 2.43e1 SMART
TPR 61 94 1.48e-7 SMART
TPR 95 128 4.52e-3 SMART
low complexity region 168 180 N/A INTRINSIC
Ubox 231 294 1.27e-28 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000123582
SMART Domains Protein: ENSMUSP00000119840
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
low complexity region 158 172 N/A INTRINSIC
low complexity region 194 208 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000133595
SMART Domains Protein: ENSMUSP00000122744
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
transmembrane domain 55 74 N/A INTRINSIC
JmjC 185 316 5.27e-2 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000152434
SMART Domains Protein: ENSMUSP00000119378
Gene: ENSMUSG00000025736

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000176751
Predicted Effect probably benign
Transcript: ENSMUST00000183929
SMART Domains Protein: ENSMUSP00000139046
Gene: ENSMUSG00000025735

DomainStartEndE-ValueType
SCOP:d2mysb_ 13 74 9e-6 SMART
Blast:EFh 43 70 2e-9 BLAST
transmembrane domain 136 155 N/A INTRINSIC
Pfam:Rhomboid 178 327 1e-27 PFAM
transmembrane domain 335 357 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184865
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing tetratricopeptide repeat and a U-box that functions as a ubiquitin ligase/cochaperone. The encoded protein binds to and ubiquitinates shock cognate 71 kDa protein (Hspa8) and DNA polymerase beta (Polb), among other targets. Mutations in this gene cause spinocerebellar ataxia, autosomal recessive 16. Alternative splicing results in multiple transcript variants. There is a pseudogene for this gene on chromosome 2. [provided by RefSeq, Jun 2014]
PHENOTYPE: Homozygous null mice develop normally but are susceptible to stress-induced apoptosis of multiple organs. Increased peri- and postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Stub1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0619:Stub1 UTSW 17 25831322 unclassified probably null
R1553:Stub1 UTSW 17 25832123 missense probably damaging 1.00
R2095:Stub1 UTSW 17 25830890 missense probably damaging 1.00
R3889:Stub1 UTSW 17 25831302 unclassified probably benign
R4626:Stub1 UTSW 17 25831871 unclassified probably null
R5070:Stub1 UTSW 17 25832138 missense probably damaging 1.00
R6223:Stub1 UTSW 17 25832813 missense probably damaging 1.00
R7159:Stub1 UTSW 17 25832064 missense probably benign 0.13
Predicted Primers PCR Primer
(F):5'- TCATGGCCAAGTTGGGGATG -3'
(R):5'- TCTTCTCTCAGGTGGACGAG -3'

Sequencing Primer
(F):5'- CCAAGTTGGGGATGAGCTG -3'
(R):5'- TCTTCTCTCAGGTGGACGAGAAAAG -3'
Posted On2019-11-12