Incidental Mutation 'R7726:Arap3'
ID 595527
Institutional Source Beutler Lab
Gene Symbol Arap3
Ensembl Gene ENSMUSG00000024451
Gene Name ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 3
Synonyms Centd3, E030006K04Rik, DRAG1
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.814) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 38105681-38132022 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 38122520 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Asparagine at position 579 (D579N)
Ref Sequence ENSEMBL: ENSMUSP00000035662 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000042944]
AlphaFold Q8R5G7
Predicted Effect probably damaging
Transcript: ENSMUST00000042944
AA Change: D579N

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000035662
Gene: ENSMUSG00000024451
AA Change: D579N

DomainStartEndE-ValueType
SAM 1 68 1.5e-7 SMART
low complexity region 81 98 N/A INTRINSIC
low complexity region 134 142 N/A INTRINSIC
PH 283 376 3.4e-16 SMART
PH 390 480 1.61e-8 SMART
ArfGap 484 606 1.44e-25 SMART
low complexity region 642 661 N/A INTRINSIC
PH 671 785 2.86e1 SMART
PH 795 901 6.87e-3 SMART
RhoGAP 913 1089 2.11e-47 SMART
Pfam:RA 1113 1206 6.2e-16 PFAM
PH 1220 1323 3.46e-8 SMART
low complexity region 1388 1407 N/A INTRINSIC
low complexity region 1457 1469 N/A INTRINSIC
low complexity region 1475 1486 N/A INTRINSIC
low complexity region 1494 1529 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: This gene encodes a phosphoinositide binding protein containing ARF-GAP, RHO-GAP, RAS-associating, and pleckstrin homology domains. The ARF-GAP and RHO-GAP domains cooperate in mediating rearrangements in the cell cytoskeleton and cell shape. It is a specific PtdIns(3,4,5)P3/PtdIns(3,4)P2-stimulated Arf6-GAP protein. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele die around E11 exhibiting pallor, embryonic growth arrest, yolk sac and placental abnormalities, and an endothelial cell-autonomous defect in sprouting angiogenesis. Knock-in mice homozygous for a point mutation display similar angiogenesis defects. [provided by MGI curators]
Allele List at MGI

All alleles(5) : Targeted(5)

Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Arap3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00515:Arap3 APN 18 38,108,979 (GRCm39) missense probably damaging 1.00
IGL01145:Arap3 APN 18 38,122,232 (GRCm39) missense probably benign
IGL01154:Arap3 APN 18 38,129,787 (GRCm39) missense probably benign 0.28
IGL01305:Arap3 APN 18 38,124,380 (GRCm39) critical splice donor site probably null
IGL01542:Arap3 APN 18 38,123,889 (GRCm39) missense probably damaging 0.98
IGL01543:Arap3 APN 18 38,123,889 (GRCm39) missense probably damaging 0.98
IGL01544:Arap3 APN 18 38,123,889 (GRCm39) missense probably damaging 0.98
IGL01545:Arap3 APN 18 38,123,889 (GRCm39) missense probably damaging 0.98
IGL01677:Arap3 APN 18 38,129,700 (GRCm39) missense probably benign
IGL01925:Arap3 APN 18 38,117,299 (GRCm39) missense probably benign 0.21
IGL01933:Arap3 APN 18 38,111,506 (GRCm39) missense possibly damaging 0.65
IGL02048:Arap3 APN 18 38,130,032 (GRCm39) missense possibly damaging 0.56
IGL02064:Arap3 APN 18 38,124,754 (GRCm39) missense probably damaging 1.00
IGL02207:Arap3 APN 18 38,120,906 (GRCm39) missense probably benign 0.00
IGL02376:Arap3 APN 18 38,111,506 (GRCm39) missense possibly damaging 0.95
IGL02531:Arap3 APN 18 38,122,804 (GRCm39) missense probably damaging 0.99
IGL02568:Arap3 APN 18 38,129,711 (GRCm39) missense probably benign 0.32
IGL02640:Arap3 APN 18 38,120,855 (GRCm39) missense possibly damaging 0.71
IGL02658:Arap3 APN 18 38,124,047 (GRCm39) missense probably benign 0.09
IGL03090:Arap3 APN 18 38,122,165 (GRCm39) missense probably benign 0.00
IGL03352:Arap3 APN 18 38,114,355 (GRCm39) splice site probably benign
ANU22:Arap3 UTSW 18 38,124,380 (GRCm39) critical splice donor site probably null
P0016:Arap3 UTSW 18 38,117,401 (GRCm39) missense probably benign 0.00
PIT4260001:Arap3 UTSW 18 38,129,948 (GRCm39) missense probably benign 0.08
R0066:Arap3 UTSW 18 38,129,760 (GRCm39) missense probably benign 0.01
R0324:Arap3 UTSW 18 38,106,278 (GRCm39) missense possibly damaging 0.93
R0562:Arap3 UTSW 18 38,108,593 (GRCm39) missense probably damaging 1.00
R1289:Arap3 UTSW 18 38,115,026 (GRCm39) missense possibly damaging 0.95
R1346:Arap3 UTSW 18 38,108,971 (GRCm39) missense probably damaging 1.00
R1419:Arap3 UTSW 18 38,111,485 (GRCm39) missense possibly damaging 0.51
R1470:Arap3 UTSW 18 38,122,249 (GRCm39) critical splice acceptor site probably null
R1470:Arap3 UTSW 18 38,122,249 (GRCm39) critical splice acceptor site probably null
R1537:Arap3 UTSW 18 38,122,737 (GRCm39) critical splice donor site probably null
R1644:Arap3 UTSW 18 38,117,298 (GRCm39) missense probably damaging 1.00
R1731:Arap3 UTSW 18 38,122,965 (GRCm39) missense probably benign 0.01
R1758:Arap3 UTSW 18 38,122,965 (GRCm39) missense probably benign 0.01
R1843:Arap3 UTSW 18 38,108,636 (GRCm39) missense probably damaging 1.00
R1907:Arap3 UTSW 18 38,129,724 (GRCm39) missense probably benign 0.28
R1954:Arap3 UTSW 18 38,115,055 (GRCm39) missense probably damaging 1.00
R2124:Arap3 UTSW 18 38,106,403 (GRCm39) missense probably damaging 0.98
R2135:Arap3 UTSW 18 38,107,509 (GRCm39) missense probably damaging 1.00
R2172:Arap3 UTSW 18 38,123,613 (GRCm39) missense probably damaging 1.00
R2418:Arap3 UTSW 18 38,122,997 (GRCm39) missense probably damaging 1.00
R2419:Arap3 UTSW 18 38,122,997 (GRCm39) missense probably damaging 1.00
R2907:Arap3 UTSW 18 38,123,580 (GRCm39) missense possibly damaging 0.88
R4425:Arap3 UTSW 18 38,111,653 (GRCm39) missense probably damaging 1.00
R4669:Arap3 UTSW 18 38,129,307 (GRCm39) missense probably benign 0.08
R4734:Arap3 UTSW 18 38,129,328 (GRCm39) missense probably benign 0.00
R4815:Arap3 UTSW 18 38,106,296 (GRCm39) missense probably benign
R5328:Arap3 UTSW 18 38,124,740 (GRCm39) missense possibly damaging 0.92
R5350:Arap3 UTSW 18 38,115,088 (GRCm39) missense probably damaging 1.00
R5466:Arap3 UTSW 18 38,129,789 (GRCm39) missense probably benign 0.00
R5482:Arap3 UTSW 18 38,107,727 (GRCm39) missense possibly damaging 0.95
R5572:Arap3 UTSW 18 38,124,119 (GRCm39) missense probably damaging 1.00
R5779:Arap3 UTSW 18 38,117,418 (GRCm39) missense probably damaging 1.00
R6053:Arap3 UTSW 18 38,123,824 (GRCm39) missense probably damaging 0.98
R6144:Arap3 UTSW 18 38,118,486 (GRCm39) missense probably damaging 0.98
R6166:Arap3 UTSW 18 38,107,423 (GRCm39) missense probably damaging 1.00
R6248:Arap3 UTSW 18 38,124,407 (GRCm39) missense probably benign 0.09
R6266:Arap3 UTSW 18 38,123,844 (GRCm39) missense probably damaging 0.98
R6385:Arap3 UTSW 18 38,130,084 (GRCm39) nonsense probably null
R6694:Arap3 UTSW 18 38,124,590 (GRCm39) critical splice donor site probably null
R6856:Arap3 UTSW 18 38,112,916 (GRCm39) missense possibly damaging 0.95
R7073:Arap3 UTSW 18 38,107,495 (GRCm39) nonsense probably null
R7297:Arap3 UTSW 18 38,106,616 (GRCm39) missense possibly damaging 0.81
R7352:Arap3 UTSW 18 38,106,331 (GRCm39) missense probably benign 0.00
R7652:Arap3 UTSW 18 38,111,505 (GRCm39) missense probably damaging 0.99
R7747:Arap3 UTSW 18 38,121,941 (GRCm39) splice site probably null
R7944:Arap3 UTSW 18 38,122,232 (GRCm39) missense probably benign
R8152:Arap3 UTSW 18 38,124,410 (GRCm39) missense possibly damaging 0.61
R8338:Arap3 UTSW 18 38,106,683 (GRCm39) missense probably damaging 0.99
R8549:Arap3 UTSW 18 38,106,365 (GRCm39) missense probably benign 0.17
R8793:Arap3 UTSW 18 38,107,492 (GRCm39) missense probably benign 0.04
R8876:Arap3 UTSW 18 38,130,077 (GRCm39) missense possibly damaging 0.67
R9142:Arap3 UTSW 18 38,112,934 (GRCm39) missense possibly damaging 0.80
R9237:Arap3 UTSW 18 38,112,934 (GRCm39) missense possibly damaging 0.80
R9583:Arap3 UTSW 18 38,109,096 (GRCm39) missense probably damaging 0.97
R9696:Arap3 UTSW 18 38,112,905 (GRCm39) missense probably damaging 1.00
X0011:Arap3 UTSW 18 38,107,154 (GRCm39) critical splice donor site probably null
X0026:Arap3 UTSW 18 38,118,364 (GRCm39) critical splice donor site probably null
X0027:Arap3 UTSW 18 38,106,538 (GRCm39) splice site probably null
X0066:Arap3 UTSW 18 38,124,699 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- CAAGAGCTCTTCCAGGAACAG -3'
(R):5'- AAAATAGACTCTGGGTCCAGC -3'

Sequencing Primer
(F):5'- CAAATGTAGCCTTTATCACCCATG -3'
(R):5'- ACTCTGGGTCCAGCTTGGG -3'
Posted On 2019-11-12