Incidental Mutation 'R7726:Spink5'
ID 595528
Institutional Source Beutler Lab
Gene Symbol Spink5
Ensembl Gene ENSMUSG00000055561
Gene Name serine peptidase inhibitor, Kazal type 5
Synonyms LEKT1, 2310065D10Rik
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 44096302-44155568 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 44096419 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Leucine to Proline at position 16 (L16P)
Ref Sequence ENSEMBL: ENSMUSP00000066214 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069245]
AlphaFold Q148R4
Predicted Effect probably damaging
Transcript: ENSMUST00000069245
AA Change: L16P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000066214
Gene: ENSMUSG00000055561
AA Change: L16P

DomainStartEndE-ValueType
PDB:1UUC|A 26 77 3e-6 PDB
KAZAL 97 152 1.67e-15 SMART
KAZAL 161 216 2.07e-3 SMART
KAZAL 226 281 3.37e-11 SMART
KAZAL 298 353 2.92e-6 SMART
KAZAL 367 424 6.73e-3 SMART
KAZAL 426 480 6.07e-4 SMART
KAZAL 496 558 2.43e-1 SMART
KAZAL 559 614 2.72e-15 SMART
KAZAL 633 687 1.95e-7 SMART
KAZAL 700 755 1.01e-9 SMART
KAZAL 769 824 7.29e-7 SMART
KAZAL 865 931 1.32e-4 SMART
KAZAL 942 996 2.74e-11 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multidomain serine protease inhibitor that contains 15 potential inhibitory domains. The encoded preproprotein is proteolytically processed to generate multiple protein products, which may exhibit unique activities and specificities. These proteins may play a role in skin and hair morphogenesis, as well as anti-inflammatory and antimicrobial protection of mucous epithelia. Mutations in this gene may result in Netherton syndrome, a disorder characterized by ichthyosis, defective cornification, and atopy. This gene is present in a gene cluster on chromosome 5. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2015]
PHENOTYPE: Homozygous mutant mice display neonatal lethality, exfoliative erythroderma, and severe dehydration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Spink5
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00226:Spink5 APN 18 44,120,938 (GRCm39) splice site probably benign
IGL00332:Spink5 APN 18 44,100,111 (GRCm39) missense probably benign 0.00
IGL00501:Spink5 APN 18 44,110,806 (GRCm39) missense probably damaging 0.98
IGL00772:Spink5 APN 18 44,139,487 (GRCm39) missense probably benign 0.02
IGL00920:Spink5 APN 18 44,136,276 (GRCm39) missense probably damaging 1.00
IGL00980:Spink5 APN 18 44,140,777 (GRCm39) missense probably damaging 1.00
IGL01016:Spink5 APN 18 44,140,711 (GRCm39) missense probably damaging 1.00
IGL01155:Spink5 APN 18 44,114,214 (GRCm39) missense probably benign 0.01
IGL01374:Spink5 APN 18 44,122,471 (GRCm39) missense possibly damaging 0.74
IGL01629:Spink5 APN 18 44,129,677 (GRCm39) splice site probably benign
IGL01907:Spink5 APN 18 44,129,743 (GRCm39) missense probably damaging 1.00
IGL01931:Spink5 APN 18 44,148,705 (GRCm39) missense probably benign 0.02
IGL02237:Spink5 APN 18 44,145,934 (GRCm39) missense probably benign 0.03
IGL02306:Spink5 APN 18 44,097,511 (GRCm39) missense probably damaging 0.98
IGL02402:Spink5 APN 18 44,100,171 (GRCm39) missense probably damaging 1.00
IGL02425:Spink5 APN 18 44,123,811 (GRCm39) critical splice donor site probably null
IGL02552:Spink5 APN 18 44,125,235 (GRCm39) missense possibly damaging 0.80
IGL02554:Spink5 APN 18 44,148,661 (GRCm39) missense probably benign 0.01
IGL03066:Spink5 APN 18 44,149,457 (GRCm39) missense probably damaging 1.00
IGL03288:Spink5 APN 18 44,147,827 (GRCm39) missense possibly damaging 0.59
crusty2 UTSW 18 44,133,001 (GRCm39) splice site probably benign
R0079:Spink5 UTSW 18 44,110,831 (GRCm39) missense probably damaging 1.00
R0184:Spink5 UTSW 18 44,136,265 (GRCm39) missense probably benign 0.00
R0452:Spink5 UTSW 18 44,096,385 (GRCm39) missense possibly damaging 0.74
R0569:Spink5 UTSW 18 44,122,486 (GRCm39) missense probably damaging 1.00
R0639:Spink5 UTSW 18 44,146,042 (GRCm39) splice site probably null
R0648:Spink5 UTSW 18 44,132,864 (GRCm39) splice site probably benign
R0705:Spink5 UTSW 18 44,125,341 (GRCm39) missense probably benign 0.01
R1170:Spink5 UTSW 18 44,116,630 (GRCm39) missense probably benign 0.07
R1290:Spink5 UTSW 18 44,140,778 (GRCm39) missense probably damaging 0.99
R1345:Spink5 UTSW 18 44,123,749 (GRCm39) missense possibly damaging 0.88
R1458:Spink5 UTSW 18 44,140,786 (GRCm39) missense probably benign 0.01
R1530:Spink5 UTSW 18 44,148,738 (GRCm39) missense probably damaging 0.96
R1570:Spink5 UTSW 18 44,100,174 (GRCm39) missense probably benign 0.00
R1820:Spink5 UTSW 18 44,122,486 (GRCm39) missense possibly damaging 0.94
R1843:Spink5 UTSW 18 44,132,958 (GRCm39) missense probably benign 0.03
R1968:Spink5 UTSW 18 44,123,775 (GRCm39) missense probably benign 0.06
R2050:Spink5 UTSW 18 44,140,825 (GRCm39) critical splice donor site probably null
R2252:Spink5 UTSW 18 44,153,891 (GRCm39) nonsense probably null
R2278:Spink5 UTSW 18 44,119,396 (GRCm39) missense probably benign 0.07
R2279:Spink5 UTSW 18 44,119,396 (GRCm39) missense probably benign 0.07
R2696:Spink5 UTSW 18 44,115,359 (GRCm39) missense probably damaging 1.00
R2992:Spink5 UTSW 18 44,129,696 (GRCm39) missense probably damaging 1.00
R3422:Spink5 UTSW 18 44,143,311 (GRCm39) missense probably benign 0.01
R3934:Spink5 UTSW 18 44,149,494 (GRCm39) missense probably damaging 1.00
R4179:Spink5 UTSW 18 44,120,934 (GRCm39) missense probably benign
R4854:Spink5 UTSW 18 44,153,908 (GRCm39) makesense probably null
R5011:Spink5 UTSW 18 44,139,479 (GRCm39) missense probably damaging 0.97
R5133:Spink5 UTSW 18 44,119,490 (GRCm39) missense probably damaging 1.00
R5163:Spink5 UTSW 18 44,132,924 (GRCm39) missense possibly damaging 0.95
R5185:Spink5 UTSW 18 44,148,711 (GRCm39) missense probably damaging 0.97
R5187:Spink5 UTSW 18 44,122,518 (GRCm39) missense probably damaging 1.00
R5292:Spink5 UTSW 18 44,139,521 (GRCm39) missense probably benign
R5332:Spink5 UTSW 18 44,125,984 (GRCm39) missense possibly damaging 0.89
R5600:Spink5 UTSW 18 44,151,778 (GRCm39) missense probably damaging 0.96
R6267:Spink5 UTSW 18 44,147,824 (GRCm39) missense probably damaging 0.99
R6296:Spink5 UTSW 18 44,147,824 (GRCm39) missense probably damaging 0.99
R6373:Spink5 UTSW 18 44,123,739 (GRCm39) missense probably damaging 1.00
R6982:Spink5 UTSW 18 44,143,109 (GRCm39) splice site probably null
R6982:Spink5 UTSW 18 44,110,792 (GRCm39) missense probably damaging 1.00
R7332:Spink5 UTSW 18 44,115,317 (GRCm39) missense probably damaging 0.96
R7396:Spink5 UTSW 18 44,110,722 (GRCm39) missense possibly damaging 0.95
R7643:Spink5 UTSW 18 44,143,319 (GRCm39) missense probably benign 0.37
R7828:Spink5 UTSW 18 44,143,296 (GRCm39) missense probably benign 0.15
R7836:Spink5 UTSW 18 44,132,888 (GRCm39) missense probably benign 0.00
R7880:Spink5 UTSW 18 44,119,393 (GRCm39) missense probably benign 0.40
R8031:Spink5 UTSW 18 44,143,303 (GRCm39) missense probably benign 0.07
R8198:Spink5 UTSW 18 44,125,947 (GRCm39) missense probably benign 0.17
R8361:Spink5 UTSW 18 44,122,529 (GRCm39) missense probably damaging 1.00
R8375:Spink5 UTSW 18 44,123,786 (GRCm39) missense probably benign 0.01
R8684:Spink5 UTSW 18 44,143,305 (GRCm39) missense probably benign 0.02
R8749:Spink5 UTSW 18 44,122,425 (GRCm39) nonsense probably null
R8918:Spink5 UTSW 18 44,100,087 (GRCm39) missense probably damaging 0.98
R9064:Spink5 UTSW 18 44,100,193 (GRCm39) missense probably damaging 1.00
R9161:Spink5 UTSW 18 44,147,986 (GRCm39) missense probably damaging 1.00
R9221:Spink5 UTSW 18 44,119,367 (GRCm39) missense probably damaging 1.00
R9292:Spink5 UTSW 18 44,148,075 (GRCm39) missense possibly damaging 0.91
R9545:Spink5 UTSW 18 44,136,262 (GRCm39) missense possibly damaging 0.88
R9784:Spink5 UTSW 18 44,119,490 (GRCm39) missense probably damaging 1.00
Z1177:Spink5 UTSW 18 44,129,764 (GRCm39) missense probably damaging 1.00
Z1177:Spink5 UTSW 18 44,129,702 (GRCm39) missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- CTAACATGAGCCTGAACAACTG -3'
(R):5'- TTGTTAGGAGGGCCTCTCAG -3'

Sequencing Primer
(F):5'- AACAACTGGTTCTGTGTGTGTCAC -3'
(R):5'- TTAGGAGGGCCTCTCAGAGATAAAAG -3'
Posted On 2019-11-12