Incidental Mutation 'R7726:Men1'
List |< first << previous [record 40 of 65] next >> last >|
ID595529
Institutional Source Beutler Lab
Gene Symbol Men1
Ensembl Gene ENSMUSG00000024947
Gene Namemultiple endocrine neoplasia 1
Synonymsmenin
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7726 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location6334979-6340891 bp(+) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) G to A at 6337282 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000109130 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025897] [ENSMUST00000056391] [ENSMUST00000078137] [ENSMUST00000079327] [ENSMUST00000113500] [ENSMUST00000113501] [ENSMUST00000113502] [ENSMUST00000113502] [ENSMUST00000113502] [ENSMUST00000113503] [ENSMUST00000113504] [ENSMUST00000124556] [ENSMUST00000130382] [ENSMUST00000142496] [ENSMUST00000152349] [ENSMUST00000166909] [ENSMUST00000170132]
Predicted Effect probably benign
Transcript: ENSMUST00000025897
SMART Domains Protein: ENSMUSP00000025897
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 273 2.41e-90 SMART
low complexity region 358 369 N/A INTRINSIC
low complexity region 425 444 N/A INTRINSIC
CNH 488 801 1.31e-128 SMART
Predicted Effect probably null
Transcript: ENSMUST00000056391
SMART Domains Protein: ENSMUSP00000058149
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000078137
SMART Domains Protein: ENSMUSP00000077272
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 396 2.6e-241 PFAM
Pfam:Menin 392 556 1.5e-62 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000079327
SMART Domains Protein: ENSMUSP00000078306
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113500
SMART Domains Protein: ENSMUSP00000109128
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113501
SMART Domains Protein: ENSMUSP00000109129
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 183 2.6e-104 PFAM
Pfam:Menin 184 576 3.2e-213 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113502
SMART Domains Protein: ENSMUSP00000109130
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 7 515 1.5e-254 PFAM
Pfam:Menin 536 615 4.9e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113502
SMART Domains Protein: ENSMUSP00000109130
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 7 515 1.5e-254 PFAM
Pfam:Menin 536 615 4.9e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113502
SMART Domains Protein: ENSMUSP00000109130
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 7 515 1.5e-254 PFAM
Pfam:Menin 536 615 4.9e-26 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113503
SMART Domains Protein: ENSMUSP00000109131
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 616 N/A PFAM
Predicted Effect probably null
Transcript: ENSMUST00000113504
SMART Domains Protein: ENSMUSP00000109132
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 611 N/A PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000124556
SMART Domains Protein: ENSMUSP00000121375
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000130382
SMART Domains Protein: ENSMUSP00000120123
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
S_TKc 16 233 3.4e-14 SMART
low complexity region 314 325 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000142496
SMART Domains Protein: ENSMUSP00000114243
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 56 4e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000152349
SMART Domains Protein: ENSMUSP00000115741
Gene: ENSMUSG00000024948

DomainStartEndE-ValueType
Pfam:Pkinase 16 57 3.7e-7 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000166909
SMART Domains Protein: ENSMUSP00000133085
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 62 8.9e-29 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000170132
SMART Domains Protein: ENSMUSP00000126655
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 1 135 1.6e-81 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000170292
SMART Domains Protein: ENSMUSP00000128607
Gene: ENSMUSG00000024947

DomainStartEndE-ValueType
Pfam:Menin 4 106 1.2e-28 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes menin, a putative tumor suppressor associated with a syndrome known as multiple endocrine neoplasia type 1. In vitro studies have shown menin is localized to the nucleus, possesses two functional nuclear localization signals, and inhibits transcriptional activation by JunD, however, the function of this protein is not known. Two messages have been detected on northern blots but the larger message has not been characterized. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2008]
PHENOTYPE: Homozygotes for targeted null mutations die at embryonic day 11.5-13.5 with reduced size, edema, open neural tube and defects of the nervous system, heart and liver. Heterozygotes develop tumors of the pancreas, parathyroid, thyroid, adrenal and pituitary. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Men1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00158:Men1 APN 19 6337207 intron probably null
IGL00160:Men1 APN 19 6337207 intron probably null
IGL00161:Men1 APN 19 6337207 intron probably null
IGL00229:Men1 APN 19 6337207 intron probably null
IGL00231:Men1 APN 19 6337207 intron probably null
IGL00232:Men1 APN 19 6337207 intron probably null
IGL00434:Men1 APN 19 6337207 intron probably null
IGL00467:Men1 APN 19 6337207 intron probably null
IGL00468:Men1 APN 19 6337207 intron probably null
IGL00470:Men1 APN 19 6337207 intron probably null
IGL00476:Men1 APN 19 6337207 intron probably null
IGL02305:Men1 APN 19 6340138 missense probably damaging 1.00
R0468:Men1 UTSW 19 6336923 missense probably null 0.99
R0856:Men1 UTSW 19 6335858 missense probably damaging 1.00
R1384:Men1 UTSW 19 6339891 missense probably benign 0.12
R1870:Men1 UTSW 19 6337630 missense probably damaging 1.00
R1987:Men1 UTSW 19 6338837 missense probably damaging 0.99
R2321:Men1 UTSW 19 6339838 missense possibly damaging 0.92
R4538:Men1 UTSW 19 6336754 missense possibly damaging 0.89
R4763:Men1 UTSW 19 6335072 critical splice donor site probably null
R6147:Men1 UTSW 19 6337242 missense probably damaging 0.97
R7598:Men1 UTSW 19 6339705 missense probably benign 0.06
RF002:Men1 UTSW 19 6340116 missense probably damaging 0.97
Predicted Primers PCR Primer
(F):5'- ATTTACGTTGCTGTGCCCTAG -3'
(R):5'- GCTTCTAGAGCCAAAGGGAG -3'

Sequencing Primer
(F):5'- AGCAGGCTCAAGGTGGTACATC -3'
(R):5'- TCTAGAGCCAAAGGGAGAGGGG -3'
Posted On2019-11-12