Incidental Mutation 'R7726:Hnrnpul2'
ID 595530
Institutional Source Beutler Lab
Gene Symbol Hnrnpul2
Ensembl Gene ENSMUSG00000071659
Gene Name heterogeneous nuclear ribonucleoprotein U-like 2
Synonyms 1110031M08Rik, Hnrpul2
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.827) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 8797374-8811507 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 8808644 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Arginine to Leucine at position 702 (R702L)
Ref Sequence ENSEMBL: ENSMUSP00000094515 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000096753]
AlphaFold Q00PI9
Predicted Effect possibly damaging
Transcript: ENSMUST00000096753
AA Change: R702L

PolyPhen 2 Score 0.613 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000094515
Gene: ENSMUSG00000071659
AA Change: R702L

DomainStartEndE-ValueType
SAP 3 37 6.03e-9 SMART
low complexity region 68 126 N/A INTRINSIC
low complexity region 224 240 N/A INTRINSIC
SPRY 287 416 5.23e-32 SMART
Pfam:AAA_33 452 597 1.2e-25 PFAM
low complexity region 637 666 N/A INTRINSIC
low complexity region 700 719 N/A INTRINSIC
low complexity region 728 745 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Hnrnpul2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01989:Hnrnpul2 APN 19 8,800,992 (GRCm39) missense probably damaging 1.00
R0136:Hnrnpul2 UTSW 19 8,804,165 (GRCm39) missense probably damaging 1.00
R0369:Hnrnpul2 UTSW 19 8,801,777 (GRCm39) missense probably damaging 1.00
R0781:Hnrnpul2 UTSW 19 8,804,110 (GRCm39) missense probably damaging 1.00
R0784:Hnrnpul2 UTSW 19 8,802,416 (GRCm39) missense possibly damaging 0.82
R1110:Hnrnpul2 UTSW 19 8,804,110 (GRCm39) missense probably damaging 1.00
R1227:Hnrnpul2 UTSW 19 8,800,601 (GRCm39) missense possibly damaging 0.91
R1589:Hnrnpul2 UTSW 19 8,808,696 (GRCm39) missense probably benign 0.00
R2126:Hnrnpul2 UTSW 19 8,801,802 (GRCm39) nonsense probably null
R2226:Hnrnpul2 UTSW 19 8,802,349 (GRCm39) missense probably damaging 0.96
R2243:Hnrnpul2 UTSW 19 8,798,001 (GRCm39) missense probably benign
R3703:Hnrnpul2 UTSW 19 8,801,773 (GRCm39) missense probably damaging 1.00
R4038:Hnrnpul2 UTSW 19 8,800,591 (GRCm39) unclassified probably benign
R4856:Hnrnpul2 UTSW 19 8,807,191 (GRCm39) missense probably benign 0.20
R4886:Hnrnpul2 UTSW 19 8,807,191 (GRCm39) missense probably benign 0.20
R5016:Hnrnpul2 UTSW 19 8,800,189 (GRCm39) missense possibly damaging 0.94
R5365:Hnrnpul2 UTSW 19 8,798,080 (GRCm39) missense probably benign
R5435:Hnrnpul2 UTSW 19 8,797,682 (GRCm39) missense probably benign 0.32
R5951:Hnrnpul2 UTSW 19 8,802,255 (GRCm39) missense probably damaging 1.00
R6181:Hnrnpul2 UTSW 19 8,800,596 (GRCm39) missense possibly damaging 0.70
R6824:Hnrnpul2 UTSW 19 8,804,081 (GRCm39) missense possibly damaging 0.89
R6924:Hnrnpul2 UTSW 19 8,808,873 (GRCm39) missense unknown
R6978:Hnrnpul2 UTSW 19 8,801,640 (GRCm39) missense probably damaging 1.00
R7602:Hnrnpul2 UTSW 19 8,808,673 (GRCm39) missense probably damaging 0.99
R7688:Hnrnpul2 UTSW 19 8,797,994 (GRCm39) missense probably benign
R7749:Hnrnpul2 UTSW 19 8,797,788 (GRCm39) missense probably benign
R7753:Hnrnpul2 UTSW 19 8,802,336 (GRCm39) missense probably damaging 1.00
R8007:Hnrnpul2 UTSW 19 8,798,179 (GRCm39) critical splice donor site probably null
R8725:Hnrnpul2 UTSW 19 8,798,064 (GRCm39) missense probably benign 0.00
R8727:Hnrnpul2 UTSW 19 8,798,064 (GRCm39) missense probably benign 0.00
R8901:Hnrnpul2 UTSW 19 8,801,809 (GRCm39) missense probably damaging 0.98
R8994:Hnrnpul2 UTSW 19 8,802,350 (GRCm39) missense probably damaging 1.00
R9012:Hnrnpul2 UTSW 19 8,801,829 (GRCm39) missense possibly damaging 0.69
R9187:Hnrnpul2 UTSW 19 8,808,319 (GRCm39) missense probably benign 0.28
R9347:Hnrnpul2 UTSW 19 8,798,080 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AGAATTTACCCTGCTTACAGTGTC -3'
(R):5'- ACCGATACCCTTGGTAACCG -3'

Sequencing Primer
(F):5'- ACCCTGCTTACAGTGTCGAGATG -3'
(R):5'- ACCGTAGTAATTCCTGTAGTATCGG -3'
Posted On 2019-11-12