Incidental Mutation 'R7726:Crtac1'
ID 595531
Institutional Source Beutler Lab
Gene Symbol Crtac1
Ensembl Gene ENSMUSG00000042401
Gene Name cartilage acidic protein 1
Synonyms Lotus, Crtac1B, 2810454P21Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.437) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 42283037-42431783 bp(-) (GRCm38)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 42302251 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 337 (S337*)
Ref Sequence ENSEMBL: ENSMUSP00000044858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048630]
AlphaFold Q8R555
Predicted Effect probably null
Transcript: ENSMUST00000048630
AA Change: S337*
SMART Domains Protein: ENSMUSP00000044858
Gene: ENSMUSG00000042401
AA Change: S337*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:VCBS 63 133 6.6e-12 PFAM
Pfam:VCBS 254 311 2e-12 PFAM
Pfam:VCBS 300 364 4.9e-13 PFAM
low complexity region 403 417 N/A INTRINSIC
Pfam:UnbV_ASPIC 459 528 8.9e-18 PFAM
Pfam:EGF_CA 560 606 2.1e-13 PFAM
low complexity region 630 646 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated extracellular matrix protein that is found in the interterritorial matrix of articular deep zone cartilage. This protein is used as a marker to distinguish chondrocytes from osteoblasts and mesenchymal stem cells in culture. The presence of FG-GAP motifs and an RGD integrin-binding motif suggests that this protein may be involved in cell-cell or cell-matrix interactions. Copy number alterations in this gene have been observed in neurofibromatosis type 1-associated glomus tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in lateral olfactory tract morphology and axon fasciculation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Crtac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Crtac1 APN 19 42323794 missense probably damaging 1.00
IGL01296:Crtac1 APN 19 42284213 missense probably damaging 1.00
IGL01991:Crtac1 APN 19 42414121 missense possibly damaging 0.96
IGL02811:Crtac1 APN 19 42333911 missense probably damaging 1.00
R1957:Crtac1 UTSW 19 42287944 missense possibly damaging 0.79
R2046:Crtac1 UTSW 19 42334053 missense probably damaging 1.00
R2125:Crtac1 UTSW 19 42323732 missense probably damaging 1.00
R2280:Crtac1 UTSW 19 42283567 missense unknown
R2281:Crtac1 UTSW 19 42283567 missense unknown
R3508:Crtac1 UTSW 19 42304741 missense probably benign 0.09
R3923:Crtac1 UTSW 19 42333947 missense probably damaging 1.00
R4072:Crtac1 UTSW 19 42304707 missense probably damaging 1.00
R4798:Crtac1 UTSW 19 42323801 missense possibly damaging 0.93
R4951:Crtac1 UTSW 19 42414131 missense probably benign
R4965:Crtac1 UTSW 19 42318740 missense probably damaging 1.00
R5190:Crtac1 UTSW 19 42333908 missense possibly damaging 0.50
R5579:Crtac1 UTSW 19 42304806 missense probably damaging 1.00
R5595:Crtac1 UTSW 19 42413951 missense probably benign 0.08
R5739:Crtac1 UTSW 19 42302173 missense probably damaging 1.00
R5872:Crtac1 UTSW 19 42309190 splice site probably null
R5936:Crtac1 UTSW 19 42323837 missense probably damaging 1.00
R6149:Crtac1 UTSW 19 42283609 missense unknown
R6193:Crtac1 UTSW 19 42323797 missense possibly damaging 0.47
R6858:Crtac1 UTSW 19 42318735 missense possibly damaging 0.93
R7246:Crtac1 UTSW 19 42287926 missense probably benign
R7991:Crtac1 UTSW 19 42333960 missense probably benign 0.24
R8046:Crtac1 UTSW 19 42309053 splice site probably benign
R8071:Crtac1 UTSW 19 42297800 missense probably damaging 1.00
R8350:Crtac1 UTSW 19 42309186 missense probably damaging 1.00
R8450:Crtac1 UTSW 19 42309186 missense probably damaging 1.00
R9756:Crtac1 UTSW 19 42298341 missense probably damaging 1.00
R9766:Crtac1 UTSW 19 42414118 missense possibly damaging 0.96
X0018:Crtac1 UTSW 19 42309114 missense probably damaging 1.00
Z1176:Crtac1 UTSW 19 42287926 missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCTCCCTGACCCTTGGAATC -3'
(R):5'- ATCTAGACCCAGCTCTGAGC -3'

Sequencing Primer
(F):5'- GACCCTTGGAATCCTGCC -3'
(R):5'- TGAGCTCCTGTGTGAACCAC -3'
Posted On 2019-11-12