Incidental Mutation 'R7726:Crtac1'
ID 595531
Institutional Source Beutler Lab
Gene Symbol Crtac1
Ensembl Gene ENSMUSG00000042401
Gene Name cartilage acidic protein 1
Synonyms Lotus, Crtac1B, 2810454P21Rik
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.487) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 42271474-42421405 bp(-) (GRCm39)
Type of Mutation nonsense
DNA Base Change (assembly) G to T at 42290690 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Serine to Stop codon at position 337 (S337*)
Ref Sequence ENSEMBL: ENSMUSP00000044858 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048630]
AlphaFold Q8R555
Predicted Effect probably null
Transcript: ENSMUST00000048630
AA Change: S337*
SMART Domains Protein: ENSMUSP00000044858
Gene: ENSMUSG00000042401
AA Change: S337*

DomainStartEndE-ValueType
signal peptide 1 28 N/A INTRINSIC
Pfam:VCBS 63 133 6.6e-12 PFAM
Pfam:VCBS 254 311 2e-12 PFAM
Pfam:VCBS 300 364 4.9e-13 PFAM
low complexity region 403 417 N/A INTRINSIC
Pfam:UnbV_ASPIC 459 528 8.9e-18 PFAM
Pfam:EGF_CA 560 606 2.1e-13 PFAM
low complexity region 630 646 N/A INTRINSIC
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a glycosylated extracellular matrix protein that is found in the interterritorial matrix of articular deep zone cartilage. This protein is used as a marker to distinguish chondrocytes from osteoblasts and mesenchymal stem cells in culture. The presence of FG-GAP motifs and an RGD integrin-binding motif suggests that this protein may be involved in cell-cell or cell-matrix interactions. Copy number alterations in this gene have been observed in neurofibromatosis type 1-associated glomus tumors. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Aug 2011]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormalities in lateral olfactory tract morphology and axon fasciculation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Crtac1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00942:Crtac1 APN 19 42,312,233 (GRCm39) missense probably damaging 1.00
IGL01296:Crtac1 APN 19 42,272,652 (GRCm39) missense probably damaging 1.00
IGL01991:Crtac1 APN 19 42,402,560 (GRCm39) missense possibly damaging 0.96
IGL02811:Crtac1 APN 19 42,322,350 (GRCm39) missense probably damaging 1.00
R1957:Crtac1 UTSW 19 42,276,383 (GRCm39) missense possibly damaging 0.79
R2046:Crtac1 UTSW 19 42,322,492 (GRCm39) missense probably damaging 1.00
R2125:Crtac1 UTSW 19 42,312,171 (GRCm39) missense probably damaging 1.00
R2280:Crtac1 UTSW 19 42,272,006 (GRCm39) missense unknown
R2281:Crtac1 UTSW 19 42,272,006 (GRCm39) missense unknown
R3508:Crtac1 UTSW 19 42,293,180 (GRCm39) missense probably benign 0.09
R3923:Crtac1 UTSW 19 42,322,386 (GRCm39) missense probably damaging 1.00
R4072:Crtac1 UTSW 19 42,293,146 (GRCm39) missense probably damaging 1.00
R4798:Crtac1 UTSW 19 42,312,240 (GRCm39) missense possibly damaging 0.93
R4951:Crtac1 UTSW 19 42,402,570 (GRCm39) missense probably benign
R4965:Crtac1 UTSW 19 42,307,179 (GRCm39) missense probably damaging 1.00
R5190:Crtac1 UTSW 19 42,322,347 (GRCm39) missense possibly damaging 0.50
R5579:Crtac1 UTSW 19 42,293,245 (GRCm39) missense probably damaging 1.00
R5595:Crtac1 UTSW 19 42,402,390 (GRCm39) missense probably benign 0.08
R5739:Crtac1 UTSW 19 42,290,612 (GRCm39) missense probably damaging 1.00
R5872:Crtac1 UTSW 19 42,297,629 (GRCm39) splice site probably null
R5936:Crtac1 UTSW 19 42,312,276 (GRCm39) missense probably damaging 1.00
R6149:Crtac1 UTSW 19 42,272,048 (GRCm39) missense unknown
R6193:Crtac1 UTSW 19 42,312,236 (GRCm39) missense possibly damaging 0.47
R6858:Crtac1 UTSW 19 42,307,174 (GRCm39) missense possibly damaging 0.93
R7246:Crtac1 UTSW 19 42,276,365 (GRCm39) missense probably benign
R7991:Crtac1 UTSW 19 42,322,399 (GRCm39) missense probably benign 0.24
R8046:Crtac1 UTSW 19 42,297,492 (GRCm39) splice site probably benign
R8071:Crtac1 UTSW 19 42,286,239 (GRCm39) missense probably damaging 1.00
R8350:Crtac1 UTSW 19 42,297,625 (GRCm39) missense probably damaging 1.00
R8450:Crtac1 UTSW 19 42,297,625 (GRCm39) missense probably damaging 1.00
R9756:Crtac1 UTSW 19 42,286,780 (GRCm39) missense probably damaging 1.00
R9766:Crtac1 UTSW 19 42,402,557 (GRCm39) missense possibly damaging 0.96
X0018:Crtac1 UTSW 19 42,297,553 (GRCm39) missense probably damaging 1.00
Z1176:Crtac1 UTSW 19 42,276,365 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- AACCTCCCTGACCCTTGGAATC -3'
(R):5'- ATCTAGACCCAGCTCTGAGC -3'

Sequencing Primer
(F):5'- GACCCTTGGAATCCTGCC -3'
(R):5'- TGAGCTCCTGTGTGAACCAC -3'
Posted On 2019-11-12