Incidental Mutation 'R7726:Col17a1'
ID595532
Institutional Source Beutler Lab
Gene Symbol Col17a1
Ensembl Gene ENSMUSG00000025064
Gene Namecollagen, type XVII, alpha 1
SynonymsBP180, Bpag2, BPAg2, Bpag
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7726 (G1)
Quality Score225.009
Status Not validated
Chromosome19
Chromosomal Location47646344-47692094 bp(-) (GRCm38)
Type of Mutationcritical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 47655190 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026045] [ENSMUST00000086923]
Predicted Effect probably null
Transcript: ENSMUST00000026045
SMART Domains Protein: ENSMUSP00000026045
Gene: ENSMUSG00000025064

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.2e-10 PFAM
low complexity region 634 651 N/A INTRINSIC
low complexity region 657 693 N/A INTRINSIC
internal_repeat_4 695 714 1.12e-5 PROSPERO
internal_repeat_3 695 723 3.81e-6 PROSPERO
internal_repeat_1 709 735 1.93e-9 PROSPERO
internal_repeat_4 719 738 1.12e-5 PROSPERO
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1201 1217 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1337 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Pfam:Collagen 1408 1462 3.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086923
SMART Domains Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.1e-10 PFAM
Pfam:Collagen 647 726 5.2e-7 PFAM
Pfam:Collagen 699 772 1.8e-9 PFAM
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1164 1180 N/A INTRINSIC
low complexity region 1215 1229 N/A INTRINSIC
low complexity region 1238 1300 N/A INTRINSIC
low complexity region 1338 1348 N/A INTRINSIC
Pfam:Collagen 1371 1425 3.5e-9 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 64 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Atrnl1 A G 19: 57,702,072 E904G probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Peg10 C CTCG 6: 4,756,453 probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Col17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Col17a1 APN 19 47681403 missense probably damaging 1.00
IGL01620:Col17a1 APN 19 47668539 missense possibly damaging 0.81
IGL02149:Col17a1 APN 19 47668632 missense probably benign 0.01
IGL02176:Col17a1 APN 19 47651219 missense probably benign 0.02
IGL03352:Col17a1 APN 19 47681375 splice site probably null
IGL03409:Col17a1 APN 19 47666540 missense possibly damaging 0.79
fleabitten UTSW 19 47668105 nonsense probably null
scabby UTSW 19 47680408 nonsense probably null
IGL03050:Col17a1 UTSW 19 47648098 critical splice donor site probably null
PIT4480001:Col17a1 UTSW 19 47671374 missense probably benign 0.05
R0309:Col17a1 UTSW 19 47671362 splice site probably benign
R0316:Col17a1 UTSW 19 47685533 critical splice donor site probably null
R0330:Col17a1 UTSW 19 47670432 missense probably benign 0.27
R0391:Col17a1 UTSW 19 47663824 missense probably damaging 0.99
R0570:Col17a1 UTSW 19 47665878 missense possibly damaging 0.93
R0737:Col17a1 UTSW 19 47669433 missense possibly damaging 0.95
R1344:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1418:Col17a1 UTSW 19 47671505 missense probably damaging 1.00
R1549:Col17a1 UTSW 19 47648910 unclassified probably benign
R1585:Col17a1 UTSW 19 47650837 missense probably benign 0.00
R1710:Col17a1 UTSW 19 47670931 missense probably damaging 1.00
R1712:Col17a1 UTSW 19 47649003 unclassified probably benign
R1800:Col17a1 UTSW 19 47650862 missense possibly damaging 0.72
R2007:Col17a1 UTSW 19 47667702 missense probably damaging 1.00
R2024:Col17a1 UTSW 19 47650746 missense probably benign 0.02
R2258:Col17a1 UTSW 19 47681377 critical splice donor site probably null
R2268:Col17a1 UTSW 19 47650111 missense probably benign 0.00
R3608:Col17a1 UTSW 19 47680405 missense probably benign 0.00
R4380:Col17a1 UTSW 19 47657090 missense possibly damaging 0.94
R4675:Col17a1 UTSW 19 47663058 critical splice acceptor site probably null
R4928:Col17a1 UTSW 19 47670458 splice site probably null
R5058:Col17a1 UTSW 19 47685550 nonsense probably null
R5407:Col17a1 UTSW 19 47666507 missense probably damaging 1.00
R5417:Col17a1 UTSW 19 47662390 missense probably damaging 1.00
R5572:Col17a1 UTSW 19 47650729 missense probably benign 0.44
R5889:Col17a1 UTSW 19 47649072 missense possibly damaging 0.93
R5988:Col17a1 UTSW 19 47654220 missense probably damaging 1.00
R6054:Col17a1 UTSW 19 47680420 missense probably damaging 1.00
R6345:Col17a1 UTSW 19 47653379 missense possibly damaging 0.93
R6432:Col17a1 UTSW 19 47680408 nonsense probably null
R6484:Col17a1 UTSW 19 47670429 missense possibly damaging 0.67
R6754:Col17a1 UTSW 19 47650721 splice site probably null
R7028:Col17a1 UTSW 19 47652183 missense probably damaging 0.96
R7465:Col17a1 UTSW 19 47668105 nonsense probably null
R7565:Col17a1 UTSW 19 47671524 missense possibly damaging 0.77
R7662:Col17a1 UTSW 19 47681501 missense probably benign 0.04
Z1088:Col17a1 UTSW 19 47652178 missense possibly damaging 0.85
Z1176:Col17a1 UTSW 19 47649429 small deletion probably benign
Z1177:Col17a1 UTSW 19 47650304 missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGGCCATTCTGACGTGACAC -3'
(R):5'- AATGCAGCCTCTCTCCTCTAGG -3'

Sequencing Primer
(F):5'- ATTCTGACGTGACACTTTGCAG -3'
(R):5'- AGCCTCTCTCCTCTAGGTCTCTC -3'
Posted On2019-11-12