Incidental Mutation 'R7726:Col17a1'
ID 595532
Institutional Source Beutler Lab
Gene Symbol Col17a1
Ensembl Gene ENSMUSG00000025064
Gene Name collagen, type XVII, alpha 1
Synonyms Bpag2, BP180, BPAg2, Bpag
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 47634783-47680460 bp(-) (GRCm39)
Type of Mutation critical splice donor site (1 bp from exon)
DNA Base Change (assembly) C to A at 47643629 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000026045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026045] [ENSMUST00000086923]
AlphaFold Q07563
Predicted Effect probably null
Transcript: ENSMUST00000026045
SMART Domains Protein: ENSMUSP00000026045
Gene: ENSMUSG00000025064

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.2e-10 PFAM
low complexity region 634 651 N/A INTRINSIC
low complexity region 657 693 N/A INTRINSIC
internal_repeat_4 695 714 1.12e-5 PROSPERO
internal_repeat_3 695 723 3.81e-6 PROSPERO
internal_repeat_1 709 735 1.93e-9 PROSPERO
internal_repeat_4 719 738 1.12e-5 PROSPERO
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1165 1177 N/A INTRINSIC
low complexity region 1201 1217 N/A INTRINSIC
low complexity region 1252 1266 N/A INTRINSIC
low complexity region 1275 1337 N/A INTRINSIC
low complexity region 1375 1385 N/A INTRINSIC
Pfam:Collagen 1408 1462 3.5e-9 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000086923
SMART Domains Protein: ENSMUSP00000084141
Gene: ENSMUSG00000025064

DomainStartEndE-ValueType
low complexity region 12 28 N/A INTRINSIC
low complexity region 60 74 N/A INTRINSIC
low complexity region 317 335 N/A INTRINSIC
low complexity region 431 461 N/A INTRINSIC
transmembrane domain 476 498 N/A INTRINSIC
Pfam:Collagen 570 631 3.1e-10 PFAM
Pfam:Collagen 647 726 5.2e-7 PFAM
Pfam:Collagen 699 772 1.8e-9 PFAM
Pfam:Collagen 753 816 1.3e-10 PFAM
Pfam:Collagen 825 871 5.9e-9 PFAM
low complexity region 889 927 N/A INTRINSIC
low complexity region 939 960 N/A INTRINSIC
low complexity region 981 999 N/A INTRINSIC
low complexity region 1024 1034 N/A INTRINSIC
low complexity region 1054 1071 N/A INTRINSIC
low complexity region 1091 1113 N/A INTRINSIC
low complexity region 1126 1147 N/A INTRINSIC
low complexity region 1164 1180 N/A INTRINSIC
low complexity region 1215 1229 N/A INTRINSIC
low complexity region 1238 1300 N/A INTRINSIC
low complexity region 1338 1348 N/A INTRINSIC
Pfam:Collagen 1371 1425 3.5e-9 PFAM
Meta Mutation Damage Score 0.9755 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele are unable to reproduce and display postnatal growth retardation, blisters and erosion at sites of trauma, nonpigmented hair growth associated with hair loss, subepidermal blistering associated with poorly formed hemidesmosomes, and high postnatal lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Atrnl1 A G 19: 57,690,504 (GRCm39) E904G probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Col17a1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00809:Col17a1 APN 19 47,669,842 (GRCm39) missense probably damaging 1.00
IGL01620:Col17a1 APN 19 47,656,978 (GRCm39) missense possibly damaging 0.81
IGL02149:Col17a1 APN 19 47,657,071 (GRCm39) missense probably benign 0.01
IGL02176:Col17a1 APN 19 47,639,658 (GRCm39) missense probably benign 0.02
IGL03352:Col17a1 APN 19 47,669,814 (GRCm39) splice site probably null
IGL03409:Col17a1 APN 19 47,654,979 (GRCm39) missense possibly damaging 0.79
fleabitten UTSW 19 47,656,544 (GRCm39) nonsense probably null
idaho UTSW 19 47,667,861 (GRCm39) nonsense probably null
scabby UTSW 19 47,668,847 (GRCm39) nonsense probably null
testimony UTSW 19 47,643,629 (GRCm39) critical splice donor site probably null
IGL03050:Col17a1 UTSW 19 47,636,537 (GRCm39) critical splice donor site probably null
PIT4480001:Col17a1 UTSW 19 47,659,813 (GRCm39) missense probably benign 0.05
R0309:Col17a1 UTSW 19 47,659,801 (GRCm39) splice site probably benign
R0316:Col17a1 UTSW 19 47,673,972 (GRCm39) critical splice donor site probably null
R0330:Col17a1 UTSW 19 47,658,871 (GRCm39) missense probably benign 0.27
R0391:Col17a1 UTSW 19 47,652,263 (GRCm39) missense probably damaging 0.99
R0570:Col17a1 UTSW 19 47,654,317 (GRCm39) missense possibly damaging 0.93
R0737:Col17a1 UTSW 19 47,657,872 (GRCm39) missense possibly damaging 0.95
R1344:Col17a1 UTSW 19 47,659,944 (GRCm39) missense probably damaging 1.00
R1418:Col17a1 UTSW 19 47,659,944 (GRCm39) missense probably damaging 1.00
R1549:Col17a1 UTSW 19 47,637,349 (GRCm39) unclassified probably benign
R1585:Col17a1 UTSW 19 47,639,276 (GRCm39) missense probably benign 0.00
R1710:Col17a1 UTSW 19 47,659,370 (GRCm39) missense probably damaging 1.00
R1712:Col17a1 UTSW 19 47,637,442 (GRCm39) unclassified probably benign
R1800:Col17a1 UTSW 19 47,639,301 (GRCm39) missense possibly damaging 0.72
R2007:Col17a1 UTSW 19 47,656,141 (GRCm39) missense probably damaging 1.00
R2024:Col17a1 UTSW 19 47,639,185 (GRCm39) missense probably benign 0.02
R2258:Col17a1 UTSW 19 47,669,816 (GRCm39) critical splice donor site probably null
R2268:Col17a1 UTSW 19 47,638,550 (GRCm39) missense probably benign 0.00
R3608:Col17a1 UTSW 19 47,668,844 (GRCm39) missense probably benign 0.00
R4380:Col17a1 UTSW 19 47,645,529 (GRCm39) missense possibly damaging 0.94
R4675:Col17a1 UTSW 19 47,651,497 (GRCm39) critical splice acceptor site probably null
R4928:Col17a1 UTSW 19 47,658,897 (GRCm39) splice site probably null
R5058:Col17a1 UTSW 19 47,673,989 (GRCm39) nonsense probably null
R5407:Col17a1 UTSW 19 47,654,946 (GRCm39) missense probably damaging 1.00
R5417:Col17a1 UTSW 19 47,650,829 (GRCm39) missense probably damaging 1.00
R5572:Col17a1 UTSW 19 47,639,168 (GRCm39) missense probably benign 0.44
R5889:Col17a1 UTSW 19 47,637,511 (GRCm39) missense possibly damaging 0.93
R5988:Col17a1 UTSW 19 47,642,659 (GRCm39) missense probably damaging 1.00
R6054:Col17a1 UTSW 19 47,668,859 (GRCm39) missense probably damaging 1.00
R6345:Col17a1 UTSW 19 47,641,818 (GRCm39) missense possibly damaging 0.93
R6432:Col17a1 UTSW 19 47,668,847 (GRCm39) nonsense probably null
R6484:Col17a1 UTSW 19 47,658,868 (GRCm39) missense possibly damaging 0.67
R6754:Col17a1 UTSW 19 47,639,160 (GRCm39) splice site probably null
R7028:Col17a1 UTSW 19 47,640,622 (GRCm39) missense probably damaging 0.96
R7465:Col17a1 UTSW 19 47,656,544 (GRCm39) nonsense probably null
R7565:Col17a1 UTSW 19 47,659,963 (GRCm39) missense possibly damaging 0.77
R7662:Col17a1 UTSW 19 47,669,940 (GRCm39) missense probably benign 0.04
R7957:Col17a1 UTSW 19 47,649,556 (GRCm39) missense probably damaging 1.00
R8677:Col17a1 UTSW 19 47,640,240 (GRCm39) missense probably benign 0.14
R8720:Col17a1 UTSW 19 47,637,531 (GRCm39) critical splice acceptor site probably benign
R8877:Col17a1 UTSW 19 47,637,197 (GRCm39) missense unknown
R9017:Col17a1 UTSW 19 47,657,898 (GRCm39) missense probably benign 0.00
R9057:Col17a1 UTSW 19 47,637,522 (GRCm39) missense probably damaging 0.96
R9231:Col17a1 UTSW 19 47,667,861 (GRCm39) nonsense probably null
R9714:Col17a1 UTSW 19 47,636,634 (GRCm39) missense unknown
Z1088:Col17a1 UTSW 19 47,640,617 (GRCm39) missense possibly damaging 0.85
Z1176:Col17a1 UTSW 19 47,637,868 (GRCm39) small deletion probably benign
Z1177:Col17a1 UTSW 19 47,638,743 (GRCm39) missense possibly damaging 0.65
Predicted Primers PCR Primer
(F):5'- TGGCCATTCTGACGTGACAC -3'
(R):5'- AATGCAGCCTCTCTCCTCTAGG -3'

Sequencing Primer
(F):5'- ATTCTGACGTGACACTTTGCAG -3'
(R):5'- AGCCTCTCTCCTCTAGGTCTCTC -3'
Posted On 2019-11-12