Mutagenetix > Incidental Mutation

Incidental Mutation 'R7726:Add3'

595533

Institutional Source

Beutler Lab

Gene Symbol

Add3

Ensembl Gene

ENSMUSG00000025026

Gene Name

adducin 3 (gamma)

Synonyms

MMRRC Submission

045782-MU

Accession Numbers

Essential gene?

Non essential (E-score: 0.000) question?

Stock #

R7726 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

53140445-53247399 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to G at 53239461 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Leucine to Valine at position 526 (L526V)

Ref Sequence

ENSEMBL: ENSMUSP00000025999 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000025999] [ENSMUST00000050096] [ENSMUST00000111741]

AlphaFold

Q9QYB5

Predicted Effect

probably damaging
Transcript: ENSMUST00000025999
AA Change: L526V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000025999
Gene: ENSMUSG00000025026
AA Change: L526V

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	101	114	N/A	INTRINSIC
Aldolase_II	139	321	1.62e-46	SMART
coiled coil region	556	582	N/A	INTRINSIC
low complexity region	590	605	N/A	INTRINSIC
low complexity region	650	662	N/A	INTRINSIC
low complexity region	673	703	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000050096
AA Change: L526V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000052245
Gene: ENSMUSG00000025026
AA Change: L526V

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	101	114	N/A	INTRINSIC
Aldolase_II	139	321	1.62e-46	SMART
low complexity region	618	630	N/A	INTRINSIC
low complexity region	641	671	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000111741
AA Change: L526V

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)

SMART Domains

Protein: ENSMUSP00000107370
Gene: ENSMUSG00000025026
AA Change: L526V

Domain	Start	End	E-Value	Type
low complexity region	2	19	N/A	INTRINSIC
low complexity region	101	114	N/A	INTRINSIC
Aldolase_II	139	321	1.62e-46	SMART
coiled coil region	556	582	N/A	INTRINSIC
low complexity region	590	605	N/A	INTRINSIC
low complexity region	650	662	N/A	INTRINSIC
low complexity region	673	703	N/A	INTRINSIC

Meta Mutation Damage Score

0.7650

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 98.8%

Validation Efficiency

100% (65/65)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Adducins are heteromeric proteins composed of different subunits referred to as adducin alpha, beta and gamma. The three subunits are encoded by distinct genes and belong to a family of membrane skeletal proteins involved in the assembly of spectrin-actin network in erythrocytes and at sites of cell-cell contact in epithelial tissues. While adducins alpha and gamma are ubiquitously expressed, the expression of adducin beta is restricted to brain and hematopoietic tissues. Adducin, originally purified from human erythrocytes, was found to be a heterodimer of adducins alpha and beta. Polymorphisms resulting in amino acid substitutions in these two subunits have been associated with the regulation of blood pressure in an animal model of hypertension. Heterodimers consisting of alpha and gamma subunits have also been described. Structurally, each subunit is comprised of two distinct domains. The amino-terminal region is protease resistant and globular in shape, while the carboxy-terminal region is protease sensitive. The latter contains multiple phosphorylation sites for protein kinase C, the binding site for calmodulin, and is required for association with spectrin and actin. Alternatively spliced adducin gamma transcripts encoding different isoforms have been described. The functions of the different isoforms are not known. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit normal blood pressure and show no significant alterations in red blood cell or platelet structure and function. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 66 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931408C20Rik	C	A	1: 26,684,498	A534S	probably benign	Het
A230050P20Rik	T	C	9: 20,873,165	Y182H	possibly damaging	Het
Adam34	T	G	8: 43,651,171	N479T	probably damaging	Het
Alas1	T	C	9: 106,246,951	T3A	probably benign	Het
Arap3	C	T	18: 37,989,467	D579N	probably damaging	Het
Armc6	C	A	8: 70,222,598	D326Y	probably damaging	Het
Atp6v1e2	G	A	17: 86,944,385	T195I	probably damaging	Het
Atrnl1	A	G	19: 57,702,072	E904G	probably damaging	Het
Bhlhe40	T	A	6: 108,662,598	D112E	probably benign	Het
Brf1	T	G	12: 112,964,245	K438T	probably benign	Het
Cabs1	A	T	5: 87,980,286	E265D	probably damaging	Het
Ccdc162	T	A	10: 41,553,075	M1937L	probably benign	Het
Cd55b	A	T	1: 130,411,493	S299R	possibly damaging	Het
Chordc1	A	G	9: 18,302,214	*120W	probably null	Het
Col17a1	C	A	19: 47,655,190		probably null	Het
Cpne8	A	T	15: 90,501,418	I469K	possibly damaging	Het
Crtac1	G	T	19: 42,302,251	S337*	probably null	Het
Cx3cl1	T	C	8: 94,780,239	S291P	probably damaging	Het
Dhx36	G	T	3: 62,488,968	Q423K	probably benign	Het
Eif3h	G	T	15: 51,786,823	Q322K	possibly damaging	Het
Ero1lb	A	G	13: 12,605,833	*494W	probably null	Het
Exph5	G	A	9: 53,373,175	V519I	possibly damaging	Het
Fam184a	C	A	10: 53,633,706	E126*	probably null	Het
Fam208a	C	A	14: 27,447,497	N338K	probably damaging	Het
Fam222b	A	G	11: 78,153,751	D46G	probably damaging	Het
Fbxl6	C	A	15: 76,535,886	R509L	probably damaging	Het
Fgf14	T	C	14: 124,136,244	Y86C	probably damaging	Het
Fras1	A	T	5: 96,712,451	I2119F	probably benign	Het
Gm14085	A	G	2: 122,486,733	E25G	probably damaging	Het
Gpr37	G	A	6: 25,669,117	T576I	possibly damaging	Het
Hnrnpul2	G	T	19: 8,831,280	R702L	possibly damaging	Het
Iqgap1	T	C	7: 80,757,456	N342S	probably benign	Het
Kcnh6	T	C	11: 106,017,575	V339A	probably benign	Het
Klk1b9	A	T	7: 43,978,416	N46I	possibly damaging	Het
Kndc1	C	A	7: 139,939,838	S1703R	possibly damaging	Het
Lyn	C	A	4: 3,756,428	Y306*	probably null	Het
Manba	C	T	3: 135,518,009	T219M	probably benign	Het
Mastl	T	C	2: 23,140,795		probably null	Het
Med15	T	G	16: 17,655,174	M550L	possibly damaging	Het
Men1	G	A	19: 6,337,282		probably null	Het
Mettl11b	A	G	1: 163,703,184	C229R	probably benign	Het
Msh4	C	T	3: 153,866,320		probably null	Het
Myh6	G	T	14: 54,965,365	D32E	probably damaging	Het
Ntn4	A	G	10: 93,733,682	D419G	possibly damaging	Het
Nup155	C	T	15: 8,122,139	P393S	probably damaging	Het
Olfr1389	T	A	11: 49,430,900	C141*	probably null	Het
Olfr1415	A	T	1: 92,491,307	F149L	probably benign	Het
Palm2	C	T	4: 57,709,876	P274S	probably damaging	Het
Papss2	A	T	19: 32,634,003		probably null	Het
Pcdhgc3	T	C	18: 37,806,879	V111A	possibly damaging	Het
Pcnx2	C	T	8: 125,850,330	V988I	probably benign	Het
Pom121	C	T	5: 135,378,148	G1178S	probably damaging	Het
Prss33	A	G	17: 23,834,229	C213R	probably damaging	Het
Scap	G	A	9: 110,378,367		probably null	Het
Sirpb1c	T	A	3: 15,848,386	I10F	possibly damaging	Het
Spink5	T	C	18: 43,963,352	L16P	probably damaging	Het
Stk4	T	G	2: 164,110,226	M1R	probably null	Het
Stub1	A	T	17: 25,831,132	Y253*	probably null	Het
Tbce	A	G	13: 14,029,290	V29A	probably damaging	Het
Tchhl1	A	G	3: 93,471,758	R590G	probably benign	Het
Tmem173	C	T	18: 35,735,265	A261T	probably damaging	Het
Ubr4	C	T	4: 139,458,920	P613L	unknown	Het
Vmn2r3	G	T	3: 64,275,518	C253*	probably null	Het
Wfdc8	C	A	2: 164,599,986	E215D	possibly damaging	Het
Zfp874b	T	C	13: 67,473,856	D441G	probably benign	Het
Zscan4d	G	T	7: 11,165,242	P36Q	possibly damaging	Het

Other mutations in Add3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01744:Add3	APN	19	53239430	missense	probably damaging	1.00
IGL02177:Add3	APN	19	53216892	nonsense	probably null
IGL03093:Add3	APN	19	53231207	missense	probably damaging	1.00
IGL03047:Add3	UTSW	19	53242591	missense	probably benign	0.00
PIT4243001:Add3	UTSW	19	53236690	missense	probably benign	0.00
PIT4366001:Add3	UTSW	19	53216867	missense	unknown
R0087:Add3	UTSW	19	53226607	missense	probably damaging	1.00
R0335:Add3	UTSW	19	53236828	missense	probably benign	0.00
R0346:Add3	UTSW	19	53216956	nonsense	probably null
R0514:Add3	UTSW	19	53236843	nonsense	probably null
R0692:Add3	UTSW	19	53216952	missense	probably damaging	1.00
R1437:Add3	UTSW	19	53233678	missense	probably damaging	0.98
R1747:Add3	UTSW	19	53242550	missense	probably benign	0.41
R2926:Add3	UTSW	19	53226822	splice site	probably null
R4192:Add3	UTSW	19	53242524	missense	probably benign	0.00
R4780:Add3	UTSW	19	53234792	missense	possibly damaging	0.64
R5019:Add3	UTSW	19	53242571	missense	probably damaging	0.99
R5486:Add3	UTSW	19	53244387	missense	probably benign	0.00
R5526:Add3	UTSW	19	53226607	missense	probably damaging	1.00
R5580:Add3	UTSW	19	53245211	missense	probably damaging	1.00
R5851:Add3	UTSW	19	53236774	missense	probably damaging	1.00
R5863:Add3	UTSW	19	53233870	missense	probably benign	0.00
R5951:Add3	UTSW	19	53244289	splice site	probably null
R6229:Add3	UTSW	19	53234846	missense	probably benign	0.35
R7017:Add3	UTSW	19	53233853	missense	possibly damaging	0.94
R7190:Add3	UTSW	19	53216899	nonsense	probably null
R7222:Add3	UTSW	19	53216846	missense	unknown
R7231:Add3	UTSW	19	53233146	missense	probably benign	0.00
R7532:Add3	UTSW	19	53232158	missense	probably damaging	1.00
R7557:Add3	UTSW	19	53239437	missense	probably damaging	0.98
R9063:Add3	UTSW	19	53233871	missense	probably damaging	0.98
R9069:Add3	UTSW	19	53233901	missense	possibly damaging	0.92
R9371:Add3	UTSW	19	53233068	missense	probably damaging	1.00
R9550:Add3	UTSW	19	53245090	missense	possibly damaging	0.82

Predicted Primers

PCR Primer
(F):5'- CAGCTAGCGTTCAGATGGTG -3'
(R):5'- TGCCTCTAAACACTGGGATG -3'

Sequencing Primer
(F):5'- TCAGATGGTGGAAAGGGCTTC -3'
(R):5'- CCTCTAAACACTGGGATGAAATGTG -3'

Posted On

2019-11-12