Incidental Mutation 'R7726:Atrnl1'
ID 595534
Institutional Source Beutler Lab
Gene Symbol Atrnl1
Ensembl Gene ENSMUSG00000054843
Gene Name attractin like 1
Synonyms Alp
MMRRC Submission 045782-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.187) question?
Stock # R7726 (G1)
Quality Score 225.009
Status Validated
Chromosome 19
Chromosomal Location 57599466-58121775 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 57690504 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamic Acid to Glycine at position 904 (E904G)
Ref Sequence ENSEMBL: ENSMUSP00000076514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077282]
AlphaFold Q6A051
Predicted Effect probably damaging
Transcript: ENSMUST00000077282
AA Change: E904G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: E904G

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
EGF 61 90 5.71e-1 SMART
CUB 92 208 1.43e-11 SMART
EGF 209 244 1.95e1 SMART
Pfam:EGF_2 248 279 5.8e-7 PFAM
Pfam:Kelch_5 350 391 2.1e-9 PFAM
Pfam:Kelch_6 354 401 5.8e-8 PFAM
Pfam:Kelch_4 465 517 4.3e-7 PFAM
Pfam:Kelch_1 519 573 2.7e-6 PFAM
PSI 613 656 3.38e-1 SMART
PSI 665 708 2e-3 SMART
PSI 714 759 1.72e-2 SMART
CLECT 747 872 2.86e-20 SMART
PSI 888 938 6.26e-5 SMART
PSI 941 1011 1.73e-7 SMART
EGF_Lam 1013 1056 1.07e-5 SMART
low complexity region 1157 1173 N/A INTRINSIC
transmembrane domain 1229 1251 N/A INTRINSIC
low complexity region 1261 1272 N/A INTRINSIC
low complexity region 1326 1339 N/A INTRINSIC
Meta Mutation Damage Score 0.2956 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam34 T G 8: 44,104,208 (GRCm39) N479T probably damaging Het
Add3 C G 19: 53,227,892 (GRCm39) L526V probably damaging Het
Alas1 T C 9: 106,124,150 (GRCm39) T3A probably benign Het
Arap3 C T 18: 38,122,520 (GRCm39) D579N probably damaging Het
Armc6 C A 8: 70,675,248 (GRCm39) D326Y probably damaging Het
Atp6v1e2 G A 17: 87,251,813 (GRCm39) T195I probably damaging Het
Bhlhe40 T A 6: 108,639,559 (GRCm39) D112E probably benign Het
Brf1 T G 12: 112,927,865 (GRCm39) K438T probably benign Het
Cabs1 A T 5: 88,128,145 (GRCm39) E265D probably damaging Het
Ccdc162 T A 10: 41,429,071 (GRCm39) M1937L probably benign Het
Cd55b A T 1: 130,339,230 (GRCm39) S299R possibly damaging Het
Chordc1 A G 9: 18,213,510 (GRCm39) *120W probably null Het
Col17a1 C A 19: 47,643,629 (GRCm39) probably null Het
Cpne8 A T 15: 90,385,621 (GRCm39) I469K possibly damaging Het
Crtac1 G T 19: 42,290,690 (GRCm39) S337* probably null Het
Cx3cl1 T C 8: 95,506,867 (GRCm39) S291P probably damaging Het
Dhx36 G T 3: 62,396,389 (GRCm39) Q423K probably benign Het
Eif3h G T 15: 51,650,219 (GRCm39) Q322K possibly damaging Het
Ero1b A G 13: 12,620,722 (GRCm39) *494W probably null Het
Exph5 G A 9: 53,284,475 (GRCm39) V519I possibly damaging Het
Fam184a C A 10: 53,509,802 (GRCm39) E126* probably null Het
Fam222b A G 11: 78,044,577 (GRCm39) D46G probably damaging Het
Fbxl6 C A 15: 76,420,086 (GRCm39) R509L probably damaging Het
Fgf14 T C 14: 124,373,656 (GRCm39) Y86C probably damaging Het
Fras1 A T 5: 96,860,310 (GRCm39) I2119F probably benign Het
Gpr37 G A 6: 25,669,116 (GRCm39) T576I possibly damaging Het
Hnrnpul2 G T 19: 8,808,644 (GRCm39) R702L possibly damaging Het
Iqgap1 T C 7: 80,407,204 (GRCm39) N342S probably benign Het
Kcnh6 T C 11: 105,908,401 (GRCm39) V339A probably benign Het
Klk1b9 A T 7: 43,627,840 (GRCm39) N46I possibly damaging Het
Kndc1 C A 7: 139,519,751 (GRCm39) S1703R possibly damaging Het
Lyn C A 4: 3,756,428 (GRCm39) Y306* probably null Het
Manba C T 3: 135,223,770 (GRCm39) T219M probably benign Het
Mastl T C 2: 23,030,807 (GRCm39) probably null Het
Med15 T G 16: 17,473,038 (GRCm39) M550L possibly damaging Het
Men1 G A 19: 6,387,312 (GRCm39) probably null Het
Msh4 C T 3: 153,571,957 (GRCm39) probably null Het
Myh6 G T 14: 55,202,822 (GRCm39) D32E probably damaging Het
Ntmt2 A G 1: 163,530,753 (GRCm39) C229R probably benign Het
Ntn4 A G 10: 93,569,544 (GRCm39) D419G possibly damaging Het
Nup155 C T 15: 8,151,623 (GRCm39) P393S probably damaging Het
Or2y1d T A 11: 49,321,727 (GRCm39) C141* probably null Het
Or6b2b A T 1: 92,419,029 (GRCm39) F149L probably benign Het
Pakap C T 4: 57,709,876 (GRCm39) P274S probably damaging Het
Papss2 A T 19: 32,611,403 (GRCm39) probably null Het
Pcdhgc3 T C 18: 37,939,932 (GRCm39) V111A possibly damaging Het
Pcnx2 C T 8: 126,577,069 (GRCm39) V988I probably benign Het
Pom121 C T 5: 135,407,002 (GRCm39) G1178S probably damaging Het
Prss33 A G 17: 24,053,203 (GRCm39) C213R probably damaging Het
Scap G A 9: 110,207,435 (GRCm39) probably null Het
Shfl T C 9: 20,784,461 (GRCm39) Y182H possibly damaging Het
Sirpb1c T A 3: 15,902,550 (GRCm39) I10F possibly damaging Het
Slc28a2b A G 2: 122,317,214 (GRCm39) E25G probably damaging Het
Spata31e2 C A 1: 26,723,579 (GRCm39) A534S probably benign Het
Spink5 T C 18: 44,096,419 (GRCm39) L16P probably damaging Het
Sting1 C T 18: 35,868,318 (GRCm39) A261T probably damaging Het
Stk4 T G 2: 163,952,146 (GRCm39) M1R probably null Het
Stub1 A T 17: 26,050,106 (GRCm39) Y253* probably null Het
Tasor C A 14: 27,169,454 (GRCm39) N338K probably damaging Het
Tbce A G 13: 14,203,875 (GRCm39) V29A probably damaging Het
Tchhl1 A G 3: 93,379,065 (GRCm39) R590G probably benign Het
Ubr4 C T 4: 139,186,231 (GRCm39) P613L unknown Het
Vmn2r3 G T 3: 64,182,939 (GRCm39) C253* probably null Het
Wfdc8 C A 2: 164,441,906 (GRCm39) E215D possibly damaging Het
Zfp874b T C 13: 67,621,975 (GRCm39) D441G probably benign Het
Zscan4d G T 7: 10,899,169 (GRCm39) P36Q possibly damaging Het
Other mutations in Atrnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Atrnl1 APN 19 57,680,249 (GRCm39) missense probably benign 0.02
IGL00707:Atrnl1 APN 19 57,661,697 (GRCm39) missense probably damaging 0.96
IGL00921:Atrnl1 APN 19 57,690,585 (GRCm39) missense probably damaging 1.00
IGL01410:Atrnl1 APN 19 58,119,536 (GRCm39) missense probably damaging 1.00
IGL01468:Atrnl1 APN 19 57,688,144 (GRCm39) missense probably benign 0.02
IGL01756:Atrnl1 APN 19 57,641,380 (GRCm39) missense probably benign
IGL01971:Atrnl1 APN 19 57,741,715 (GRCm39) missense probably damaging 1.00
IGL02019:Atrnl1 APN 19 57,680,195 (GRCm39) splice site probably benign
IGL02580:Atrnl1 APN 19 57,703,008 (GRCm39) splice site probably benign
IGL02649:Atrnl1 APN 19 57,638,873 (GRCm39) splice site probably benign
IGL02676:Atrnl1 APN 19 57,680,316 (GRCm39) missense probably damaging 1.00
IGL03276:Atrnl1 APN 19 57,641,359 (GRCm39) missense probably damaging 0.99
IGL03379:Atrnl1 APN 19 57,630,973 (GRCm39) missense probably benign 0.02
Magnetogorsk UTSW 19 57,618,738 (GRCm39) missense probably damaging 1.00
polar UTSW 19 57,641,382 (GRCm39) missense probably benign 0.00
PIT4812001:Atrnl1 UTSW 19 57,720,055 (GRCm39) missense probably benign 0.08
R0109:Atrnl1 UTSW 19 57,743,949 (GRCm39) missense possibly damaging 0.78
R0308:Atrnl1 UTSW 19 57,741,720 (GRCm39) missense probably benign 0.04
R0394:Atrnl1 UTSW 19 57,661,608 (GRCm39) missense probably benign 0.10
R0734:Atrnl1 UTSW 19 57,643,293 (GRCm39) missense probably damaging 1.00
R0811:Atrnl1 UTSW 19 57,661,573 (GRCm39) missense probably benign 0.07
R0812:Atrnl1 UTSW 19 57,661,573 (GRCm39) missense probably benign 0.07
R1183:Atrnl1 UTSW 19 57,638,725 (GRCm39) missense probably damaging 0.97
R1213:Atrnl1 UTSW 19 57,626,894 (GRCm39) missense probably benign 0.25
R1344:Atrnl1 UTSW 19 57,924,137 (GRCm39) critical splice donor site probably null
R1418:Atrnl1 UTSW 19 57,924,137 (GRCm39) critical splice donor site probably null
R1707:Atrnl1 UTSW 19 57,675,169 (GRCm39) missense probably benign 0.00
R1748:Atrnl1 UTSW 19 57,703,134 (GRCm39) missense probably damaging 0.99
R2051:Atrnl1 UTSW 19 57,680,281 (GRCm39) missense probably benign 0.01
R2113:Atrnl1 UTSW 19 57,744,048 (GRCm39) nonsense probably null
R2130:Atrnl1 UTSW 19 57,643,426 (GRCm39) missense probably damaging 1.00
R3710:Atrnl1 UTSW 19 57,645,546 (GRCm39) missense probably damaging 1.00
R3916:Atrnl1 UTSW 19 57,924,084 (GRCm39) missense possibly damaging 0.82
R4524:Atrnl1 UTSW 19 57,618,738 (GRCm39) missense probably damaging 1.00
R4707:Atrnl1 UTSW 19 57,617,590 (GRCm39) missense probably damaging 0.97
R4712:Atrnl1 UTSW 19 57,641,382 (GRCm39) missense probably benign 0.00
R4784:Atrnl1 UTSW 19 57,617,590 (GRCm39) missense probably damaging 0.97
R4785:Atrnl1 UTSW 19 57,617,590 (GRCm39) missense probably damaging 0.97
R4798:Atrnl1 UTSW 19 58,030,793 (GRCm39) missense probably benign
R5172:Atrnl1 UTSW 19 57,673,945 (GRCm39) nonsense probably null
R5226:Atrnl1 UTSW 19 57,638,767 (GRCm39) missense probably benign
R5289:Atrnl1 UTSW 19 57,645,514 (GRCm39) missense probably damaging 1.00
R5372:Atrnl1 UTSW 19 57,743,968 (GRCm39) missense probably benign
R5737:Atrnl1 UTSW 19 57,766,320 (GRCm39) missense possibly damaging 0.84
R5782:Atrnl1 UTSW 19 57,741,718 (GRCm39) missense possibly damaging 0.95
R5826:Atrnl1 UTSW 19 57,618,724 (GRCm39) nonsense probably null
R6169:Atrnl1 UTSW 19 57,630,895 (GRCm39) missense probably benign 0.00
R6242:Atrnl1 UTSW 19 57,630,910 (GRCm39) missense probably benign 0.02
R6342:Atrnl1 UTSW 19 57,626,942 (GRCm39) missense probably damaging 1.00
R6372:Atrnl1 UTSW 19 57,638,764 (GRCm39) missense probably benign 0.01
R6811:Atrnl1 UTSW 19 57,643,393 (GRCm39) missense probably damaging 0.98
R6897:Atrnl1 UTSW 19 58,030,800 (GRCm39) missense probably benign 0.01
R7024:Atrnl1 UTSW 19 57,626,882 (GRCm39) critical splice acceptor site probably null
R7085:Atrnl1 UTSW 19 57,680,289 (GRCm39) missense probably damaging 1.00
R7144:Atrnl1 UTSW 19 58,030,784 (GRCm39) missense probably damaging 1.00
R7259:Atrnl1 UTSW 19 57,924,038 (GRCm39) nonsense probably null
R7289:Atrnl1 UTSW 19 57,638,846 (GRCm39) missense probably benign 0.13
R7310:Atrnl1 UTSW 19 57,630,856 (GRCm39) missense possibly damaging 0.69
R7372:Atrnl1 UTSW 19 57,924,078 (GRCm39) missense possibly damaging 0.47
R7432:Atrnl1 UTSW 19 57,743,956 (GRCm39) missense probably damaging 1.00
R7478:Atrnl1 UTSW 19 57,684,744 (GRCm39) missense possibly damaging 0.89
R7556:Atrnl1 UTSW 19 57,643,278 (GRCm39) missense probably benign
R7567:Atrnl1 UTSW 19 57,687,955 (GRCm39) missense probably damaging 0.98
R7608:Atrnl1 UTSW 19 57,703,119 (GRCm39) missense probably damaging 1.00
R7632:Atrnl1 UTSW 19 57,618,738 (GRCm39) missense probably damaging 1.00
R7655:Atrnl1 UTSW 19 57,599,811 (GRCm39) nonsense probably null
R7656:Atrnl1 UTSW 19 57,599,811 (GRCm39) nonsense probably null
R7718:Atrnl1 UTSW 19 57,728,615 (GRCm39) nonsense probably null
R7721:Atrnl1 UTSW 19 57,684,763 (GRCm39) missense probably benign 0.00
R7733:Atrnl1 UTSW 19 57,690,420 (GRCm39) missense probably benign 0.00
R7774:Atrnl1 UTSW 19 57,688,103 (GRCm39) missense probably damaging 1.00
R8010:Atrnl1 UTSW 19 57,670,878 (GRCm39) missense probably benign 0.14
R8119:Atrnl1 UTSW 19 57,630,895 (GRCm39) missense probably benign 0.00
R9242:Atrnl1 UTSW 19 57,645,660 (GRCm39) missense probably benign 0.07
R9265:Atrnl1 UTSW 19 57,766,359 (GRCm39) missense probably benign 0.11
R9272:Atrnl1 UTSW 19 57,643,420 (GRCm39) missense probably benign 0.00
R9480:Atrnl1 UTSW 19 57,690,420 (GRCm39) missense possibly damaging 0.61
R9526:Atrnl1 UTSW 19 57,617,551 (GRCm39) missense probably damaging 0.99
R9672:Atrnl1 UTSW 19 57,618,695 (GRCm39) missense possibly damaging 0.87
R9673:Atrnl1 UTSW 19 57,599,786 (GRCm39) start codon destroyed probably null 0.04
RF021:Atrnl1 UTSW 19 57,630,905 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACCCGGTCATTTGTGTTG -3'
(R):5'- TTGAGACTGAGACCTCTCTATAATAGC -3'

Sequencing Primer
(F):5'- CATTAGTTGTAAGATCGGACGCCC -3'
(R):5'- GTAATGCCCTGGAGTGTT -3'
Posted On 2019-11-12