Incidental Mutation 'R7726:Atrnl1'
List |< first << previous [record 9 of 65] next >> last >|
ID595534
Institutional Source Beutler Lab
Gene Symbol Atrnl1
Ensembl Gene ENSMUSG00000054843
Gene Nameattractin like 1
SynonymsAlp
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.162) question?
Stock #R7726 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location57611034-58133338 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57702072 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 904 (E904G)
Ref Sequence ENSEMBL: ENSMUSP00000076514 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000077282]
Predicted Effect probably damaging
Transcript: ENSMUST00000077282
AA Change: E904G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000076514
Gene: ENSMUSG00000054843
AA Change: E904G

DomainStartEndE-ValueType
low complexity region 25 32 N/A INTRINSIC
EGF 61 90 5.71e-1 SMART
CUB 92 208 1.43e-11 SMART
EGF 209 244 1.95e1 SMART
Pfam:EGF_2 248 279 5.8e-7 PFAM
Pfam:Kelch_5 350 391 2.1e-9 PFAM
Pfam:Kelch_6 354 401 5.8e-8 PFAM
Pfam:Kelch_4 465 517 4.3e-7 PFAM
Pfam:Kelch_1 519 573 2.7e-6 PFAM
PSI 613 656 3.38e-1 SMART
PSI 665 708 2e-3 SMART
PSI 714 759 1.72e-2 SMART
CLECT 747 872 2.86e-20 SMART
PSI 888 938 6.26e-5 SMART
PSI 941 1011 1.73e-7 SMART
EGF_Lam 1013 1056 1.07e-5 SMART
low complexity region 1157 1173 N/A INTRINSIC
transmembrane domain 1229 1251 N/A INTRINSIC
low complexity region 1261 1272 N/A INTRINSIC
low complexity region 1326 1339 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.8%
Validation Efficiency 100% (65/65)
MGI Phenotype PHENOTYPE: Mice homozygous for a null allele exhibit normal coat coloring and normal brain morphology. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 66 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4931408C20Rik C A 1: 26,684,498 A534S probably benign Het
A230050P20Rik T C 9: 20,873,165 Y182H possibly damaging Het
Adam34 T G 8: 43,651,171 N479T probably damaging Het
Add3 C G 19: 53,239,461 L526V probably damaging Het
Alas1 T C 9: 106,246,951 T3A probably benign Het
Arap3 C T 18: 37,989,467 D579N probably damaging Het
Armc6 C A 8: 70,222,598 D326Y probably damaging Het
Atp6v1e2 G A 17: 86,944,385 T195I probably damaging Het
Bhlhe40 T A 6: 108,662,598 D112E probably benign Het
Brf1 T G 12: 112,964,245 K438T probably benign Het
Cabs1 A T 5: 87,980,286 E265D probably damaging Het
Ccdc162 T A 10: 41,553,075 M1937L probably benign Het
Cd55b A T 1: 130,411,493 S299R possibly damaging Het
Chordc1 A G 9: 18,302,214 *120W probably null Het
Col17a1 C A 19: 47,655,190 probably null Het
Cpne8 A T 15: 90,501,418 I469K possibly damaging Het
Crtac1 G T 19: 42,302,251 S337* probably null Het
Cx3cl1 T C 8: 94,780,239 S291P probably damaging Het
Dhx36 G T 3: 62,488,968 Q423K probably benign Het
Eif3h G T 15: 51,786,823 Q322K possibly damaging Het
Ero1lb A G 13: 12,605,833 *494W probably null Het
Exph5 G A 9: 53,373,175 V519I possibly damaging Het
Fam184a C A 10: 53,633,706 E126* probably null Het
Fam208a C A 14: 27,447,497 N338K probably damaging Het
Fam222b A G 11: 78,153,751 D46G probably damaging Het
Fbxl6 C A 15: 76,535,886 R509L probably damaging Het
Fgf14 T C 14: 124,136,244 Y86C probably damaging Het
Fras1 A T 5: 96,712,451 I2119F probably benign Het
Gm14085 A G 2: 122,486,733 E25G probably damaging Het
Gpr37 G A 6: 25,669,117 T576I possibly damaging Het
Hnrnpul2 G T 19: 8,831,280 R702L possibly damaging Het
Iqgap1 T C 7: 80,757,456 N342S probably benign Het
Kcnh6 T C 11: 106,017,575 V339A probably benign Het
Klk1b9 A T 7: 43,978,416 N46I possibly damaging Het
Kndc1 C A 7: 139,939,838 S1703R possibly damaging Het
Lyn C A 4: 3,756,428 Y306* probably null Het
Manba C T 3: 135,518,009 T219M probably benign Het
Mastl T C 2: 23,140,795 probably null Het
Med15 T G 16: 17,655,174 M550L possibly damaging Het
Men1 G A 19: 6,337,282 probably null Het
Mettl11b A G 1: 163,703,184 C229R probably benign Het
Msh4 C T 3: 153,866,320 probably null Het
Myh6 G T 14: 54,965,365 D32E probably damaging Het
Ntn4 A G 10: 93,733,682 D419G possibly damaging Het
Nup155 C T 15: 8,122,139 P393S probably damaging Het
Olfr1389 T A 11: 49,430,900 C141* probably null Het
Olfr1415 A T 1: 92,491,307 F149L probably benign Het
Palm2 C T 4: 57,709,876 P274S probably damaging Het
Papss2 A T 19: 32,634,003 probably null Het
Pcdhgc3 T C 18: 37,806,879 V111A possibly damaging Het
Pcnx2 C T 8: 125,850,330 V988I probably benign Het
Pom121 C T 5: 135,378,148 G1178S probably damaging Het
Prss33 A G 17: 23,834,229 C213R probably damaging Het
Scap G A 9: 110,378,367 probably null Het
Sirpb1c T A 3: 15,848,386 I10F possibly damaging Het
Spink5 T C 18: 43,963,352 L16P probably damaging Het
Stk4 T G 2: 164,110,226 M1R probably null Het
Stub1 A T 17: 25,831,132 Y253* probably null Het
Tbce A G 13: 14,029,290 V29A probably damaging Het
Tchhl1 A G 3: 93,471,758 R590G probably benign Het
Tmem173 C T 18: 35,735,265 A261T probably damaging Het
Ubr4 C T 4: 139,458,920 P613L unknown Het
Vmn2r3 G T 3: 64,275,518 C253* probably null Het
Wfdc8 C A 2: 164,599,986 E215D possibly damaging Het
Zfp874b T C 13: 67,473,856 D441G probably benign Het
Zscan4d G T 7: 11,165,242 P36Q possibly damaging Het
Other mutations in Atrnl1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00323:Atrnl1 APN 19 57691817 missense probably benign 0.02
IGL00707:Atrnl1 APN 19 57673265 missense probably damaging 0.96
IGL00921:Atrnl1 APN 19 57702153 missense probably damaging 1.00
IGL01410:Atrnl1 APN 19 58131104 missense probably damaging 1.00
IGL01468:Atrnl1 APN 19 57699712 missense probably benign 0.02
IGL01756:Atrnl1 APN 19 57652948 missense probably benign
IGL01971:Atrnl1 APN 19 57753283 missense probably damaging 1.00
IGL02019:Atrnl1 APN 19 57691763 splice site probably benign
IGL02580:Atrnl1 APN 19 57714576 splice site probably benign
IGL02649:Atrnl1 APN 19 57650441 splice site probably benign
IGL02676:Atrnl1 APN 19 57691884 missense probably damaging 1.00
IGL03276:Atrnl1 APN 19 57652927 missense probably damaging 0.99
IGL03379:Atrnl1 APN 19 57642541 missense probably benign 0.02
Magnetogorsk UTSW 19 57630306 missense probably damaging 1.00
polar UTSW 19 57652950 missense probably benign 0.00
PIT4812001:Atrnl1 UTSW 19 57731623 missense probably benign 0.08
R0109:Atrnl1 UTSW 19 57755517 missense possibly damaging 0.78
R0308:Atrnl1 UTSW 19 57753288 missense probably benign 0.04
R0394:Atrnl1 UTSW 19 57673176 missense probably benign 0.10
R0734:Atrnl1 UTSW 19 57654861 missense probably damaging 1.00
R0811:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R0812:Atrnl1 UTSW 19 57673141 missense probably benign 0.07
R1183:Atrnl1 UTSW 19 57650293 missense probably damaging 0.97
R1213:Atrnl1 UTSW 19 57638462 missense probably benign 0.25
R1344:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1418:Atrnl1 UTSW 19 57935705 critical splice donor site probably null
R1707:Atrnl1 UTSW 19 57686737 missense probably benign 0.00
R1748:Atrnl1 UTSW 19 57714702 missense probably damaging 0.99
R2051:Atrnl1 UTSW 19 57691849 missense probably benign 0.01
R2113:Atrnl1 UTSW 19 57755616 nonsense probably null
R2130:Atrnl1 UTSW 19 57654994 missense probably damaging 1.00
R3710:Atrnl1 UTSW 19 57657114 missense probably damaging 1.00
R3916:Atrnl1 UTSW 19 57935652 missense possibly damaging 0.82
R4524:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R4707:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4712:Atrnl1 UTSW 19 57652950 missense probably benign 0.00
R4784:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4785:Atrnl1 UTSW 19 57629158 missense probably damaging 0.97
R4798:Atrnl1 UTSW 19 58042361 missense probably benign
R5172:Atrnl1 UTSW 19 57685513 nonsense probably null
R5226:Atrnl1 UTSW 19 57650335 missense probably benign
R5289:Atrnl1 UTSW 19 57657082 missense probably damaging 1.00
R5372:Atrnl1 UTSW 19 57755536 missense probably benign
R5737:Atrnl1 UTSW 19 57777888 missense possibly damaging 0.84
R5782:Atrnl1 UTSW 19 57753286 missense possibly damaging 0.95
R5826:Atrnl1 UTSW 19 57630292 nonsense probably null
R6169:Atrnl1 UTSW 19 57642463 missense probably benign 0.00
R6242:Atrnl1 UTSW 19 57642478 missense probably benign 0.02
R6342:Atrnl1 UTSW 19 57638510 missense probably damaging 1.00
R6372:Atrnl1 UTSW 19 57650332 missense probably benign 0.01
R6811:Atrnl1 UTSW 19 57654961 missense probably damaging 0.98
R6897:Atrnl1 UTSW 19 58042368 missense probably benign 0.01
R7024:Atrnl1 UTSW 19 57638450 critical splice acceptor site probably null
R7085:Atrnl1 UTSW 19 57691857 missense probably damaging 1.00
R7144:Atrnl1 UTSW 19 58042352 missense probably damaging 1.00
R7259:Atrnl1 UTSW 19 57935606 nonsense probably null
R7289:Atrnl1 UTSW 19 57650414 missense probably benign 0.13
R7310:Atrnl1 UTSW 19 57642424 missense possibly damaging 0.69
R7372:Atrnl1 UTSW 19 57935646 missense possibly damaging 0.47
R7432:Atrnl1 UTSW 19 57755524 missense probably damaging 1.00
R7478:Atrnl1 UTSW 19 57696312 missense possibly damaging 0.89
R7556:Atrnl1 UTSW 19 57654846 missense probably benign
R7567:Atrnl1 UTSW 19 57699523 missense probably damaging 0.98
R7608:Atrnl1 UTSW 19 57714687 missense probably damaging 1.00
R7632:Atrnl1 UTSW 19 57630306 missense probably damaging 1.00
R7655:Atrnl1 UTSW 19 57611379 nonsense probably null
R7656:Atrnl1 UTSW 19 57611379 nonsense probably null
R7718:Atrnl1 UTSW 19 57740183 nonsense probably null
R7721:Atrnl1 UTSW 19 57696331 missense probably benign 0.00
R7733:Atrnl1 UTSW 19 57701988 missense probably benign 0.00
R7774:Atrnl1 UTSW 19 57699671 missense probably damaging 1.00
R8010:Atrnl1 UTSW 19 57682446 missense probably benign 0.14
RF021:Atrnl1 UTSW 19 57642473 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAACCCGGTCATTTGTGTTG -3'
(R):5'- TTGAGACTGAGACCTCTCTATAATAGC -3'

Sequencing Primer
(F):5'- CATTAGTTGTAAGATCGGACGCCC -3'
(R):5'- GTAATGCCCTGGAGTGTT -3'
Posted On2019-11-12