Incidental Mutation 'R7727:Col4a4'
ID 595536
Institutional Source Beutler Lab
Gene Symbol Col4a4
Ensembl Gene ENSMUSG00000067158
Gene Name collagen, type IV, alpha 4
Synonyms E130010M05Rik, [a]4(IV)
MMRRC Submission 045783-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.106) question?
Stock # R7727 (G1)
Quality Score 225.009
Status Validated
Chromosome 1
Chromosomal Location 82426144-82564570 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to C at 82506514 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Valine at position 269 (M269V)
Ref Sequence ENSEMBL: ENSMUSP00000084282 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000087050]
AlphaFold Q9QZR9
Predicted Effect unknown
Transcript: ENSMUST00000087050
AA Change: M269V
SMART Domains Protein: ENSMUSP00000084282
Gene: ENSMUSG00000067158
AA Change: M269V

DomainStartEndE-ValueType
low complexity region 29 41 N/A INTRINSIC
Pfam:Collagen 54 113 4e-11 PFAM
Pfam:Collagen 110 168 4.1e-10 PFAM
Pfam:Collagen 172 229 2.8e-10 PFAM
low complexity region 265 288 N/A INTRINSIC
internal_repeat_7 289 345 1.46e-9 PROSPERO
internal_repeat_6 291 348 5.03e-10 PROSPERO
internal_repeat_9 297 353 7.22e-9 PROSPERO
internal_repeat_4 322 354 2.06e-11 PROSPERO
internal_repeat_11 334 349 1.25e-5 PROSPERO
Pfam:Collagen 392 449 1.3e-8 PFAM
low complexity region 461 482 N/A INTRINSIC
Pfam:Collagen 486 553 1e-10 PFAM
low complexity region 563 595 N/A INTRINSIC
Pfam:Collagen 597 658 1e-8 PFAM
Pfam:Collagen 663 731 4.4e-10 PFAM
Pfam:Collagen 755 810 3.3e-9 PFAM
internal_repeat_2 816 841 2.9e-13 PROSPERO
Pfam:Collagen 844 912 1.8e-10 PFAM
Pfam:Collagen 898 962 2.7e-10 PFAM
low complexity region 963 1003 N/A INTRINSIC
Pfam:Collagen 1006 1071 2e-10 PFAM
Pfam:Collagen 1073 1132 5.8e-12 PFAM
Pfam:Collagen 1124 1185 1.8e-10 PFAM
Pfam:Collagen 1187 1245 2.3e-8 PFAM
low complexity region 1277 1361 N/A INTRINSIC
low complexity region 1371 1384 N/A INTRINSIC
Pfam:Collagen 1395 1454 4.3e-8 PFAM
C4 1457 1564 3.36e-58 SMART
C4 1565 1681 1.49e-59 SMART
Meta Mutation Damage Score 0.0869 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes one of the six subunits of type IV collagen, the major structural component of basement membranes. This particular collagen IV subunit, however, is only found in a subset of basement membranes. Like the other members of the type IV collagen gene family, this gene is organized in a head-to-head conformation with another type IV collagen gene so that each gene pair shares a common promoter. Mutations in this gene are associated with type II autosomal recessive Alport syndrome (hereditary glomerulonephropathy) and with familial benign hematuria (thin basement membrane disease). Two transcripts, differing only in their transcription start sites, have been identified for this gene and, as is common for collagen genes, multiple polyadenylation sites are found in the 3' UTR. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for an ENU-induced mutation develop an early nephritic syndrome associated with uremia, proteinuria, hematuria, leukocyturia, and focal segmental glomerulosclerosis, and die prematurely of kidney failure. Some homozygotes exhibit moderatesensorineural hearing loss. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A T 16: 85,696,854 (GRCm39) L101Q probably damaging Het
Arhgap18 A T 10: 26,746,007 (GRCm39) I293F possibly damaging Het
Atp8b1 T A 18: 64,678,346 (GRCm39) Q850L probably damaging Het
B4galnt3 A T 6: 120,202,148 (GRCm39) F118Y probably benign Het
Bcl6 A G 16: 23,790,163 (GRCm39) probably null Het
Cc2d2b T A 19: 40,744,974 (GRCm39) L31Q probably benign Het
Cd5l G T 3: 87,275,162 (GRCm39) E234* probably null Het
Cemip2 C T 19: 21,807,321 (GRCm39) L917F probably benign Het
Cfap65 T C 1: 74,965,784 (GRCm39) T409A probably benign Het
Chst5 A T 8: 112,617,557 (GRCm39) I21N probably benign Het
Cldn20 T C 17: 3,583,030 (GRCm39) Y68H probably benign Het
Dgkh A G 14: 78,832,585 (GRCm39) probably null Het
Dpp6 A G 5: 27,656,242 (GRCm39) T166A probably benign Het
Drosha A G 15: 12,881,731 (GRCm39) D754G probably damaging Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Fsd1 T G 17: 56,295,150 (GRCm39) D46E probably benign Het
Gabra1 T C 11: 42,024,418 (GRCm39) D419G probably damaging Het
Golga4 T A 9: 118,377,770 (GRCm39) D458E probably damaging Het
Grm6 C A 11: 50,742,369 (GRCm39) A134E probably benign Het
Ikzf1 T A 11: 11,698,339 (GRCm39) S63R probably damaging Het
Ilvbl G A 10: 78,412,500 (GRCm39) V74I probably benign Het
Kcng2 C T 18: 80,339,305 (GRCm39) V328M probably benign Het
Kpna7 T C 5: 144,941,855 (GRCm39) E145G probably benign Het
Krt81 A G 15: 101,357,448 (GRCm39) V428A probably damaging Het
Lalba T C 15: 98,380,549 (GRCm39) M2V probably benign Het
Lrpprc T C 17: 85,084,375 (GRCm39) S113G probably benign Het
Mboat1 A C 13: 30,410,289 (GRCm39) M249L probably benign Het
Meltf T C 16: 31,702,612 (GRCm39) V113A probably damaging Het
Muc16 T A 9: 18,571,538 (GRCm39) H327L unknown Het
Myh1 A G 11: 67,106,748 (GRCm39) I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Naga C A 15: 82,214,348 (GRCm39) V388L probably benign Het
Nfkb1 A C 3: 135,291,162 (GRCm39) M957R possibly damaging Het
Nol12 C A 15: 78,824,793 (GRCm39) S157* probably null Het
Or13c25 A G 4: 52,911,368 (GRCm39) V142A possibly damaging Het
Or5g23 A G 2: 85,438,751 (GRCm39) F168L possibly damaging Het
Or8u3-ps A T 2: 85,952,840 (GRCm39) D191V possibly damaging Het
Pcdhga5 T C 18: 37,828,098 (GRCm39) V182A probably benign Het
Pik3r4 A G 9: 105,547,081 (GRCm39) E953G probably damaging Het
Piwil2 C T 14: 70,631,506 (GRCm39) R646Q probably damaging Het
Plxnc1 T C 10: 94,779,971 (GRCm39) H157R probably damaging Het
Prrg4 A T 2: 104,669,723 (GRCm39) F131L probably benign Het
Prss3b C A 6: 41,010,127 (GRCm39) R69L probably benign Het
Rab28 A G 5: 41,865,313 (GRCm39) S4P probably damaging Het
Ranbp2 C A 10: 58,291,260 (GRCm39) Q209K probably benign Het
Schip1 G A 3: 67,972,317 (GRCm39) D15N probably benign Het
Serpina3f T G 12: 104,184,477 (GRCm39) M207R probably benign Het
Sgsm1 A T 5: 113,422,193 (GRCm39) M487K possibly damaging Het
Sh3tc2 A T 18: 62,122,651 (GRCm39) I471F probably benign Het
Slamf1 G A 1: 171,602,467 (GRCm39) V65I possibly damaging Het
Slit3 T C 11: 35,574,871 (GRCm39) C1062R probably damaging Het
Snapc4 T G 2: 26,263,446 (GRCm39) K344N probably damaging Het
Sorl1 A G 9: 41,895,822 (GRCm39) Y1778H probably damaging Het
Spon2 G A 5: 33,373,019 (GRCm39) R228C probably damaging Het
Sv2c A G 13: 96,113,203 (GRCm39) I582T possibly damaging Het
Tamm41 C T 6: 114,993,139 (GRCm39) V205M probably damaging Het
Trpm2 T C 10: 77,761,623 (GRCm39) D1009G probably benign Het
Trpm6 T C 19: 18,831,613 (GRCm39) S1493P probably damaging Het
Ttc34 G A 4: 154,923,731 (GRCm39) V147I possibly damaging Het
Tut7 A G 13: 59,947,496 (GRCm39) F942L probably benign Het
Uba2 C T 7: 33,850,275 (GRCm39) A393T probably damaging Het
Ubn2 T A 6: 38,440,873 (GRCm39) N416K probably benign Het
Uevld T C 7: 46,593,553 (GRCm39) N233S probably benign Het
Upp2 G A 2: 58,664,160 (GRCm39) M142I possibly damaging Het
Vps52 T A 17: 34,181,108 (GRCm39) V450D probably benign Het
Wdr31 A T 4: 62,378,873 (GRCm39) F118Y probably damaging Het
Zfp110 T A 7: 12,582,922 (GRCm39) D523E possibly damaging Het
Zfp367 A T 13: 64,293,457 (GRCm39) V143D probably damaging Het
Zfp950 T C 19: 61,108,379 (GRCm39) I235V probably benign Het
Other mutations in Col4a4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00402:Col4a4 APN 1 82,469,362 (GRCm39) missense unknown
IGL01092:Col4a4 APN 1 82,444,266 (GRCm39) missense unknown
IGL01104:Col4a4 APN 1 82,444,266 (GRCm39) missense unknown
IGL01413:Col4a4 APN 1 82,448,969 (GRCm39) missense unknown
IGL01518:Col4a4 APN 1 82,433,480 (GRCm39) missense unknown
IGL02014:Col4a4 APN 1 82,501,681 (GRCm39) splice site probably benign
IGL02215:Col4a4 APN 1 82,431,530 (GRCm39) missense unknown
IGL02707:Col4a4 APN 1 82,471,237 (GRCm39) missense unknown
IGL02858:Col4a4 APN 1 82,506,204 (GRCm39) missense unknown
IGL02987:Col4a4 APN 1 82,476,646 (GRCm39) splice site probably benign
IGL03384:Col4a4 APN 1 82,462,159 (GRCm39) missense probably benign 0.04
amazement UTSW 1 82,458,207 (GRCm39) nonsense probably null
aoba UTSW 1 82,513,461 (GRCm39) critical splice donor site probably benign
asombro UTSW 1 82,466,730 (GRCm39) critical splice donor site probably null
astonishment UTSW 1 82,433,449 (GRCm39) missense unknown
wonderment UTSW 1 82,430,865 (GRCm39) missense unknown
IGL02980:Col4a4 UTSW 1 82,447,198 (GRCm39) critical splice donor site probably null
R0028:Col4a4 UTSW 1 82,465,231 (GRCm39) critical splice donor site probably null
R0083:Col4a4 UTSW 1 82,484,832 (GRCm39) critical splice acceptor site probably null
R0696:Col4a4 UTSW 1 82,470,270 (GRCm39) missense unknown
R0788:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0789:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0790:Col4a4 UTSW 1 82,502,717 (GRCm39) missense unknown
R0894:Col4a4 UTSW 1 82,507,377 (GRCm39) splice site probably null
R1217:Col4a4 UTSW 1 82,466,730 (GRCm39) critical splice donor site probably null
R1465:Col4a4 UTSW 1 82,475,543 (GRCm39) splice site probably null
R1465:Col4a4 UTSW 1 82,475,543 (GRCm39) splice site probably null
R1474:Col4a4 UTSW 1 82,458,207 (GRCm39) nonsense probably null
R1508:Col4a4 UTSW 1 82,433,557 (GRCm39) missense unknown
R1640:Col4a4 UTSW 1 82,513,491 (GRCm39) missense unknown
R1678:Col4a4 UTSW 1 82,464,380 (GRCm39) missense unknown
R1827:Col4a4 UTSW 1 82,517,709 (GRCm39) missense unknown
R1930:Col4a4 UTSW 1 82,444,321 (GRCm39) splice site probably null
R1931:Col4a4 UTSW 1 82,444,321 (GRCm39) splice site probably null
R2092:Col4a4 UTSW 1 82,476,667 (GRCm39) missense unknown
R2122:Col4a4 UTSW 1 82,434,592 (GRCm39) missense unknown
R2132:Col4a4 UTSW 1 82,475,581 (GRCm39) missense unknown
R2396:Col4a4 UTSW 1 82,484,793 (GRCm39) missense unknown
R2418:Col4a4 UTSW 1 82,510,657 (GRCm39) missense unknown
R2679:Col4a4 UTSW 1 82,507,332 (GRCm39) missense unknown
R3085:Col4a4 UTSW 1 82,507,285 (GRCm39) critical splice donor site probably null
R3437:Col4a4 UTSW 1 82,474,889 (GRCm39) missense unknown
R3697:Col4a4 UTSW 1 82,518,958 (GRCm39) missense unknown
R3730:Col4a4 UTSW 1 82,433,472 (GRCm39) splice site probably null
R3752:Col4a4 UTSW 1 82,458,215 (GRCm39) missense probably damaging 0.97
R4085:Col4a4 UTSW 1 82,448,909 (GRCm39) critical splice donor site probably null
R4087:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4088:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4090:Col4a4 UTSW 1 82,501,643 (GRCm39) missense unknown
R4213:Col4a4 UTSW 1 82,430,865 (GRCm39) missense unknown
R4422:Col4a4 UTSW 1 82,467,559 (GRCm39) missense unknown
R4596:Col4a4 UTSW 1 82,448,940 (GRCm39) missense unknown
R4755:Col4a4 UTSW 1 82,518,895 (GRCm39) missense unknown
R4757:Col4a4 UTSW 1 82,506,187 (GRCm39) missense unknown
R4793:Col4a4 UTSW 1 82,516,820 (GRCm39) missense unknown
R4812:Col4a4 UTSW 1 82,439,874 (GRCm39) missense unknown
R4833:Col4a4 UTSW 1 82,507,323 (GRCm39) missense unknown
R5259:Col4a4 UTSW 1 82,431,614 (GRCm39) missense unknown
R5264:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5265:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5281:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5283:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5284:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5387:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5388:Col4a4 UTSW 1 82,471,312 (GRCm39) missense unknown
R5435:Col4a4 UTSW 1 82,431,728 (GRCm39) missense unknown
R5534:Col4a4 UTSW 1 82,465,238 (GRCm39) missense unknown
R5666:Col4a4 UTSW 1 82,463,300 (GRCm39) critical splice donor site probably null
R5670:Col4a4 UTSW 1 82,463,300 (GRCm39) critical splice donor site probably null
R5943:Col4a4 UTSW 1 82,502,737 (GRCm39) missense unknown
R5996:Col4a4 UTSW 1 82,433,449 (GRCm39) missense unknown
R5999:Col4a4 UTSW 1 82,470,340 (GRCm39) missense unknown
R6112:Col4a4 UTSW 1 82,431,604 (GRCm39) missense unknown
R6192:Col4a4 UTSW 1 82,462,151 (GRCm39) missense probably damaging 1.00
R6237:Col4a4 UTSW 1 82,484,752 (GRCm39) missense unknown
R6419:Col4a4 UTSW 1 82,444,207 (GRCm39) critical splice donor site probably null
R6458:Col4a4 UTSW 1 82,433,546 (GRCm39) missense unknown
R6460:Col4a4 UTSW 1 82,444,253 (GRCm39) missense unknown
R6481:Col4a4 UTSW 1 82,431,499 (GRCm39) missense unknown
R6522:Col4a4 UTSW 1 82,465,304 (GRCm39) missense unknown
R7000:Col4a4 UTSW 1 82,475,051 (GRCm39) missense unknown
R7015:Col4a4 UTSW 1 82,484,671 (GRCm39) missense unknown
R7055:Col4a4 UTSW 1 82,496,757 (GRCm39) missense unknown
R7288:Col4a4 UTSW 1 82,470,184 (GRCm39) missense unknown
R7293:Col4a4 UTSW 1 82,501,664 (GRCm39) missense unknown
R7300:Col4a4 UTSW 1 82,464,361 (GRCm39) missense unknown
R7458:Col4a4 UTSW 1 82,476,669 (GRCm39) missense unknown
R7520:Col4a4 UTSW 1 82,484,808 (GRCm39) nonsense probably null
R7803:Col4a4 UTSW 1 82,467,419 (GRCm39) critical splice donor site probably null
R7953:Col4a4 UTSW 1 82,431,689 (GRCm39) missense unknown
R7959:Col4a4 UTSW 1 82,484,780 (GRCm39) missense unknown
R7982:Col4a4 UTSW 1 82,549,162 (GRCm39) start gained probably benign
R8000:Col4a4 UTSW 1 82,519,018 (GRCm39) missense unknown
R8057:Col4a4 UTSW 1 82,501,591 (GRCm39) missense unknown
R8126:Col4a4 UTSW 1 82,431,007 (GRCm39) missense unknown
R8406:Col4a4 UTSW 1 82,501,611 (GRCm39) missense unknown
R8699:Col4a4 UTSW 1 82,433,455 (GRCm39) missense unknown
R8835:Col4a4 UTSW 1 82,447,313 (GRCm39) missense unknown
R8916:Col4a4 UTSW 1 82,501,667 (GRCm39) missense unknown
R8921:Col4a4 UTSW 1 82,431,533 (GRCm39) missense unknown
R8990:Col4a4 UTSW 1 82,473,555 (GRCm39) missense unknown
R9002:Col4a4 UTSW 1 82,449,032 (GRCm39) missense probably benign 0.26
R9116:Col4a4 UTSW 1 82,431,752 (GRCm39) missense unknown
R9176:Col4a4 UTSW 1 82,463,349 (GRCm39) missense unknown
R9211:Col4a4 UTSW 1 82,506,501 (GRCm39) missense unknown
R9246:Col4a4 UTSW 1 82,430,956 (GRCm39) missense unknown
R9463:Col4a4 UTSW 1 82,431,076 (GRCm39) missense unknown
R9666:Col4a4 UTSW 1 82,496,670 (GRCm39) missense unknown
R9686:Col4a4 UTSW 1 82,474,962 (GRCm39) missense unknown
R9705:Col4a4 UTSW 1 82,465,313 (GRCm39) missense unknown
R9749:Col4a4 UTSW 1 82,463,353 (GRCm39) missense unknown
R9774:Col4a4 UTSW 1 82,484,665 (GRCm39) critical splice donor site probably null
X0020:Col4a4 UTSW 1 82,517,673 (GRCm39) critical splice donor site probably null
Z1088:Col4a4 UTSW 1 82,430,917 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- GCAACAGTTTAAAGAGAGCAACTTC -3'
(R):5'- TGCTTTTCCCATGGACCCAAG -3'

Sequencing Primer
(F):5'- AGCAACTTCCTTAGAATGGAGG -3'
(R):5'- CCAGGGATACAGATGTACTTCGGTC -3'
Posted On 2019-11-12