Incidental Mutation 'R7727:Olfr1000'
ID 595540
Institutional Source Beutler Lab
Gene Symbol Olfr1000
Ensembl Gene ENSMUSG00000075215
Gene Name olfactory receptor 1000
Synonyms MOR175-9, GA_x6K02T2Q125-47087719-47086775
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock # R7727 (G1)
Quality Score 225.009
Status Validated
Chromosome 2
Chromosomal Location 85607037-85611903 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to G at 85608407 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 168 (F168L)
Ref Sequence ENSEMBL: ENSMUSP00000149982 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099921] [ENSMUST00000213837] [ENSMUST00000216571]
AlphaFold Q7TR99
Predicted Effect possibly damaging
Transcript: ENSMUST00000099921
AA Change: F168L

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000097505
Gene: ENSMUSG00000075215
AA Change: F168L

DomainStartEndE-ValueType
Pfam:7tm_4 31 308 1.1e-49 PFAM
Pfam:7tm_1 41 290 2.9e-17 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000213837
AA Change: F168L

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
Predicted Effect possibly damaging
Transcript: ENSMUST00000216571
AA Change: F168L

PolyPhen 2 Score 0.723 (Sensitivity: 0.86; Specificity: 0.92)
Meta Mutation Damage Score 0.1712 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Adamts5 A T 16: 85,899,966 L101Q probably damaging Het
Arhgap18 A T 10: 26,870,011 I293F possibly damaging Het
Atp8b1 T A 18: 64,545,275 Q850L probably damaging Het
B4galnt3 A T 6: 120,225,187 F118Y probably benign Het
Bcl6 A G 16: 23,971,413 probably null Het
Cc2d2b T A 19: 40,756,530 L31Q probably benign Het
Cd5l G T 3: 87,367,855 E234* probably null Het
Cfap65 T C 1: 74,926,625 T409A probably benign Het
Chst5 A T 8: 111,890,925 I21N probably benign Het
Cldn20 T C 17: 3,532,755 Y68H probably benign Het
Col4a4 T C 1: 82,528,793 M269V unknown Het
Dgkh A G 14: 78,595,145 probably null Het
Dpp6 A G 5: 27,451,244 T166A probably benign Het
Drosha A G 15: 12,881,645 D754G probably damaging Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Fsd1 T G 17: 55,988,150 D46E probably benign Het
Gabra1 T C 11: 42,133,591 D419G probably damaging Het
Golga4 T A 9: 118,548,702 D458E probably damaging Het
Grm6 C A 11: 50,851,542 A134E probably benign Het
Ikzf1 T A 11: 11,748,339 S63R probably damaging Het
Ilvbl G A 10: 78,576,666 V74I probably benign Het
Kcng2 C T 18: 80,296,090 V328M probably benign Het
Kpna7 T C 5: 145,005,045 E145G probably benign Het
Krt81 A G 15: 101,459,567 V428A probably damaging Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lrpprc T C 17: 84,776,947 S113G probably benign Het
Mboat1 A C 13: 30,226,306 M249L probably benign Het
Meltf T C 16: 31,883,794 V113A probably damaging Het
Muc16 T A 9: 18,660,242 H327L unknown Het
Myh1 A G 11: 67,215,922 I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Naga C A 15: 82,330,147 V388L probably benign Het
Nfkb1 A C 3: 135,585,401 M957R possibly damaging Het
Nol12 C A 15: 78,940,593 S157* probably null Het
Olfr1038-ps A T 2: 86,122,496 D191V possibly damaging Het
Olfr272 A G 4: 52,911,368 V142A possibly damaging Het
Pcdhga5 T C 18: 37,695,045 V182A probably benign Het
Pik3r4 A G 9: 105,669,882 E953G probably damaging Het
Piwil2 C T 14: 70,394,057 R646Q probably damaging Het
Plxnc1 T C 10: 94,944,109 H157R probably damaging Het
Prrg4 A T 2: 104,839,378 F131L probably benign Het
Rab28 A G 5: 41,707,970 S4P probably damaging Het
Ranbp2 C A 10: 58,455,438 Q209K probably benign Het
Schip1 G A 3: 68,064,984 D15N probably benign Het
Serpina3f T G 12: 104,218,218 M207R probably benign Het
Sgsm1 A T 5: 113,274,327 M487K possibly damaging Het
Sh3tc2 A T 18: 61,989,580 I471F probably benign Het
Slamf1 G A 1: 171,774,899 V65I possibly damaging Het
Slit3 T C 11: 35,684,044 C1062R probably damaging Het
Snapc4 T G 2: 26,373,434 K344N probably damaging Het
Sorl1 A G 9: 41,984,526 Y1778H probably damaging Het
Spon2 G A 5: 33,215,675 R228C probably damaging Het
Sv2c A G 13: 95,976,695 I582T possibly damaging Het
Tamm41 C T 6: 115,016,178 V205M probably damaging Het
Tmem2 C T 19: 21,829,957 L917F probably benign Het
Trpm2 T C 10: 77,925,789 D1009G probably benign Het
Trpm6 T C 19: 18,854,249 S1493P probably damaging Het
Ttc34 G A 4: 154,839,274 V147I possibly damaging Het
Uba2 C T 7: 34,150,850 A393T probably damaging Het
Ubn2 T A 6: 38,463,938 N416K probably benign Het
Uevld T C 7: 46,943,805 N233S probably benign Het
Upp2 G A 2: 58,774,148 M142I possibly damaging Het
Vps52 T A 17: 33,962,134 V450D probably benign Het
Wdr31 A T 4: 62,460,636 F118Y probably damaging Het
Zcchc6 A G 13: 59,799,682 F942L probably benign Het
Zfp110 T A 7: 12,848,995 D523E possibly damaging Het
Zfp367 A T 13: 64,145,643 V143D probably damaging Het
Zfp950 T C 19: 61,119,941 I235V probably benign Het
Other mutations in Olfr1000
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01548:Olfr1000 APN 2 85608761 missense probably benign
IGL01872:Olfr1000 APN 2 85608329 missense probably benign
IGL01955:Olfr1000 APN 2 85608707 missense probably benign 0.12
IGL02132:Olfr1000 APN 2 85608320 missense probably benign 0.00
IGL02139:Olfr1000 APN 2 85608230 nonsense probably null
IGL02717:Olfr1000 APN 2 85608772 missense probably damaging 1.00
IGL02950:Olfr1000 APN 2 85608157 missense possibly damaging 0.92
R1866:Olfr1000 UTSW 2 85608844 missense probably benign 0.05
R1868:Olfr1000 UTSW 2 85608065 missense probably damaging 0.98
R1869:Olfr1000 UTSW 2 85608500 missense probably benign 0.23
R2256:Olfr1000 UTSW 2 85608463 missense possibly damaging 0.81
R2919:Olfr1000 UTSW 2 85608410 missense probably benign 0.06
R4736:Olfr1000 UTSW 2 85607983 missense probably benign
R5197:Olfr1000 UTSW 2 85608447 missense probably benign 0.01
R5256:Olfr1000 UTSW 2 85608473 missense probably benign
R5367:Olfr1000 UTSW 2 85608374 missense probably damaging 0.99
R5389:Olfr1000 UTSW 2 85608283 missense probably benign
R6991:Olfr1000 UTSW 2 85608248 missense possibly damaging 0.76
R7017:Olfr1000 UTSW 2 85608329 missense probably benign
R7020:Olfr1000 UTSW 2 85608632 missense probably benign 0.11
R7352:Olfr1000 UTSW 2 85608784 missense probably damaging 1.00
R7392:Olfr1000 UTSW 2 85608488 missense possibly damaging 0.61
R7586:Olfr1000 UTSW 2 85608184 missense probably damaging 0.99
R8053:Olfr1000 UTSW 2 85608890 missense probably damaging 0.98
R8108:Olfr1000 UTSW 2 85608749 missense possibly damaging 0.94
R9332:Olfr1000 UTSW 2 85607987 nonsense probably null
Predicted Primers PCR Primer
(F):5'- AGCGACAGTCACCAAGTGAG -3'
(R):5'- ACTGAATGCTTTCTCCTGGC -3'

Sequencing Primer
(F):5'- GGCTGTCTGAATCTTCAAAATTGCC -3'
(R):5'- TCTCCTGGCTGCCATGG -3'
Posted On 2019-11-12