Incidental Mutation 'R7727:Nfkb1'
ID 595545
Institutional Source Beutler Lab
Gene Symbol Nfkb1
Ensembl Gene ENSMUSG00000028163
Gene Name nuclear factor of kappa light polypeptide gene enhancer in B cells 1, p105
Synonyms p50, p50/p105, NF-kappaB, nuclear factor kappaB p50, NF kappaB1, p50 subunit of NF kappaB, NF-kappaB p50
MMRRC Submission 045783-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7727 (G1)
Quality Score 225.009
Status Validated
Chromosome 3
Chromosomal Location 135290416-135397308 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to C at 135291162 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Methionine to Arginine at position 957 (M957R)
Ref Sequence ENSEMBL: ENSMUSP00000029812 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000029812] [ENSMUST00000164430] [ENSMUST00000196469]
AlphaFold P25799
Predicted Effect possibly damaging
Transcript: ENSMUST00000029812
AA Change: M957R

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000029812
Gene: ENSMUSG00000028163
AA Change: M957R

DomainStartEndE-ValueType
Pfam:RHD 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000132668
SMART Domains Protein: ENSMUSP00000114798
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
low complexity region 8 54 N/A INTRINSIC
Blast:IPT 55 156 4e-22 BLAST
ANK 178 208 2.27e1 SMART
ANK 217 246 1.11e-2 SMART
ANK 250 280 2.47e0 SMART
ANK 286 315 5.53e-3 SMART
ANK 320 350 1.9e-1 SMART
ANK 354 383 2.18e-1 SMART
Blast:DEATH 441 505 1e-34 BLAST
PDB:2DBF|A 442 505 5e-32 PDB
Predicted Effect possibly damaging
Transcript: ENSMUST00000164430
AA Change: M957R

PolyPhen 2 Score 0.480 (Sensitivity: 0.89; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000128345
Gene: ENSMUSG00000028163
AA Change: M957R

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 240 2.9e-75 PFAM
IPT 247 348 1.14e-22 SMART
low complexity region 368 414 N/A INTRINSIC
ANK 538 568 2.27e1 SMART
ANK 577 606 1.11e-2 SMART
ANK 610 640 2.47e0 SMART
ANK 646 675 5.53e-3 SMART
ANK 680 710 1.9e-1 SMART
ANK 714 743 2.18e-1 SMART
DEATH 801 888 1.9e-19 SMART
low complexity region 890 902 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000184550
Predicted Effect probably benign
Transcript: ENSMUST00000196469
SMART Domains Protein: ENSMUSP00000143601
Gene: ENSMUSG00000028163

DomainStartEndE-ValueType
Pfam:RHD_DNA_bind 42 90 2.5e-19 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 105 kD protein which can undergo cotranslational processing by the 26S proteasome to produce a 50 kD protein. The 105 kD protein is a Rel protein-specific transcription inhibitor and the 50 kD protein is a DNA binding subunit of the NF-kappa-B (NFKB) protein complex. NFKB is a transcription regulator that is activated by various intra- and extra-cellular stimuli such as cytokines, oxidant-free radicals, ultraviolet irradiation, and bacterial or viral products. Activated NFKB translocates into the nucleus and stimulates the expression of genes involved in a wide variety of biological functions. Inappropriate activation of NFKB has been associated with a number of inflammatory diseases while persistent inhibition of NFKB leads to inappropriate immune cell development or delayed cell growth. Alternative splicing results in multiple transcript variants encoding different isoforms, at least one of which is proteolytically processed. [provided by RefSeq, Feb 2016]
PHENOTYPE: Homozygous null mice have a decreased survivor rate, abnormal T cell development and decreased number of peripheral T cells, abnormal humoral responses with decreased immunoglobulin class switching, exhibit mild organ inflammation, and are susceptible toboth bacterial infections and hearing loss. [provided by MGI curators]
Allele List at MGI

All alleles(79) : Targeted(5) Gene trapped(74)

Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A T 16: 85,696,854 (GRCm39) L101Q probably damaging Het
Arhgap18 A T 10: 26,746,007 (GRCm39) I293F possibly damaging Het
Atp8b1 T A 18: 64,678,346 (GRCm39) Q850L probably damaging Het
B4galnt3 A T 6: 120,202,148 (GRCm39) F118Y probably benign Het
Bcl6 A G 16: 23,790,163 (GRCm39) probably null Het
Cc2d2b T A 19: 40,744,974 (GRCm39) L31Q probably benign Het
Cd5l G T 3: 87,275,162 (GRCm39) E234* probably null Het
Cemip2 C T 19: 21,807,321 (GRCm39) L917F probably benign Het
Cfap65 T C 1: 74,965,784 (GRCm39) T409A probably benign Het
Chst5 A T 8: 112,617,557 (GRCm39) I21N probably benign Het
Cldn20 T C 17: 3,583,030 (GRCm39) Y68H probably benign Het
Col4a4 T C 1: 82,506,514 (GRCm39) M269V unknown Het
Dgkh A G 14: 78,832,585 (GRCm39) probably null Het
Dpp6 A G 5: 27,656,242 (GRCm39) T166A probably benign Het
Drosha A G 15: 12,881,731 (GRCm39) D754G probably damaging Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Fsd1 T G 17: 56,295,150 (GRCm39) D46E probably benign Het
Gabra1 T C 11: 42,024,418 (GRCm39) D419G probably damaging Het
Golga4 T A 9: 118,377,770 (GRCm39) D458E probably damaging Het
Grm6 C A 11: 50,742,369 (GRCm39) A134E probably benign Het
Ikzf1 T A 11: 11,698,339 (GRCm39) S63R probably damaging Het
Ilvbl G A 10: 78,412,500 (GRCm39) V74I probably benign Het
Kcng2 C T 18: 80,339,305 (GRCm39) V328M probably benign Het
Kpna7 T C 5: 144,941,855 (GRCm39) E145G probably benign Het
Krt81 A G 15: 101,357,448 (GRCm39) V428A probably damaging Het
Lalba T C 15: 98,380,549 (GRCm39) M2V probably benign Het
Lrpprc T C 17: 85,084,375 (GRCm39) S113G probably benign Het
Mboat1 A C 13: 30,410,289 (GRCm39) M249L probably benign Het
Meltf T C 16: 31,702,612 (GRCm39) V113A probably damaging Het
Muc16 T A 9: 18,571,538 (GRCm39) H327L unknown Het
Myh1 A G 11: 67,106,748 (GRCm39) I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Naga C A 15: 82,214,348 (GRCm39) V388L probably benign Het
Nol12 C A 15: 78,824,793 (GRCm39) S157* probably null Het
Or13c25 A G 4: 52,911,368 (GRCm39) V142A possibly damaging Het
Or5g23 A G 2: 85,438,751 (GRCm39) F168L possibly damaging Het
Or8u3-ps A T 2: 85,952,840 (GRCm39) D191V possibly damaging Het
Pcdhga5 T C 18: 37,828,098 (GRCm39) V182A probably benign Het
Pik3r4 A G 9: 105,547,081 (GRCm39) E953G probably damaging Het
Piwil2 C T 14: 70,631,506 (GRCm39) R646Q probably damaging Het
Plxnc1 T C 10: 94,779,971 (GRCm39) H157R probably damaging Het
Prrg4 A T 2: 104,669,723 (GRCm39) F131L probably benign Het
Prss3b C A 6: 41,010,127 (GRCm39) R69L probably benign Het
Rab28 A G 5: 41,865,313 (GRCm39) S4P probably damaging Het
Ranbp2 C A 10: 58,291,260 (GRCm39) Q209K probably benign Het
Schip1 G A 3: 67,972,317 (GRCm39) D15N probably benign Het
Serpina3f T G 12: 104,184,477 (GRCm39) M207R probably benign Het
Sgsm1 A T 5: 113,422,193 (GRCm39) M487K possibly damaging Het
Sh3tc2 A T 18: 62,122,651 (GRCm39) I471F probably benign Het
Slamf1 G A 1: 171,602,467 (GRCm39) V65I possibly damaging Het
Slit3 T C 11: 35,574,871 (GRCm39) C1062R probably damaging Het
Snapc4 T G 2: 26,263,446 (GRCm39) K344N probably damaging Het
Sorl1 A G 9: 41,895,822 (GRCm39) Y1778H probably damaging Het
Spon2 G A 5: 33,373,019 (GRCm39) R228C probably damaging Het
Sv2c A G 13: 96,113,203 (GRCm39) I582T possibly damaging Het
Tamm41 C T 6: 114,993,139 (GRCm39) V205M probably damaging Het
Trpm2 T C 10: 77,761,623 (GRCm39) D1009G probably benign Het
Trpm6 T C 19: 18,831,613 (GRCm39) S1493P probably damaging Het
Ttc34 G A 4: 154,923,731 (GRCm39) V147I possibly damaging Het
Tut7 A G 13: 59,947,496 (GRCm39) F942L probably benign Het
Uba2 C T 7: 33,850,275 (GRCm39) A393T probably damaging Het
Ubn2 T A 6: 38,440,873 (GRCm39) N416K probably benign Het
Uevld T C 7: 46,593,553 (GRCm39) N233S probably benign Het
Upp2 G A 2: 58,664,160 (GRCm39) M142I possibly damaging Het
Vps52 T A 17: 34,181,108 (GRCm39) V450D probably benign Het
Wdr31 A T 4: 62,378,873 (GRCm39) F118Y probably damaging Het
Zfp110 T A 7: 12,582,922 (GRCm39) D523E possibly damaging Het
Zfp367 A T 13: 64,293,457 (GRCm39) V143D probably damaging Het
Zfp950 T C 19: 61,108,379 (GRCm39) I235V probably benign Het
Other mutations in Nfkb1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01293:Nfkb1 APN 3 135,296,600 (GRCm39) missense probably damaging 1.00
IGL01345:Nfkb1 APN 3 135,300,742 (GRCm39) missense probably damaging 1.00
IGL01629:Nfkb1 APN 3 135,307,228 (GRCm39) missense probably benign
IGL02216:Nfkb1 APN 3 135,300,724 (GRCm39) missense probably damaging 0.98
IGL02273:Nfkb1 APN 3 135,310,968 (GRCm39) missense probably benign 0.01
IGL02508:Nfkb1 APN 3 135,296,579 (GRCm39) missense probably damaging 0.99
IGL03095:Nfkb1 APN 3 135,324,591 (GRCm39) missense possibly damaging 0.48
Conversely UTSW 3 135,332,420 (GRCm39) missense probably damaging 1.00
Finlay UTSW 3 135,300,814 (GRCm39) nonsense probably null
Frisbee UTSW 3 135,319,704 (GRCm39) missense possibly damaging 0.93
Honeyeater UTSW 3 135,297,312 (GRCm39) splice site probably benign
kookaburra UTSW 3 135,332,372 (GRCm39) nonsense probably null
Murgatroyd UTSW 3 135,332,471 (GRCm39) missense possibly damaging 0.72
Poderoso UTSW 3 135,319,751 (GRCm39) missense probably damaging 1.00
Puff UTSW 3 135,300,814 (GRCm39) nonsense probably null
Roomba UTSW 3 135,318,173 (GRCm39) critical splice donor site probably null
Wheelo UTSW 3 135,321,110 (GRCm39) missense possibly damaging 0.81
R0026:Nfkb1 UTSW 3 135,297,334 (GRCm39) missense probably damaging 1.00
R0047:Nfkb1 UTSW 3 135,300,814 (GRCm39) nonsense probably null
R0989:Nfkb1 UTSW 3 135,295,157 (GRCm39) missense probably benign 0.00
R1210:Nfkb1 UTSW 3 135,300,688 (GRCm39) missense probably benign 0.03
R1661:Nfkb1 UTSW 3 135,300,718 (GRCm39) missense probably damaging 1.00
R1665:Nfkb1 UTSW 3 135,300,718 (GRCm39) missense probably damaging 1.00
R1725:Nfkb1 UTSW 3 135,373,519 (GRCm39) missense probably damaging 1.00
R1984:Nfkb1 UTSW 3 135,321,110 (GRCm39) missense possibly damaging 0.81
R1985:Nfkb1 UTSW 3 135,321,110 (GRCm39) missense possibly damaging 0.81
R2154:Nfkb1 UTSW 3 135,307,240 (GRCm39) missense probably benign 0.44
R2281:Nfkb1 UTSW 3 135,307,282 (GRCm39) missense probably damaging 1.00
R2409:Nfkb1 UTSW 3 135,319,704 (GRCm39) missense possibly damaging 0.93
R2504:Nfkb1 UTSW 3 135,295,090 (GRCm39) missense possibly damaging 0.51
R4032:Nfkb1 UTSW 3 135,300,110 (GRCm39) missense possibly damaging 0.63
R4232:Nfkb1 UTSW 3 135,309,531 (GRCm39) missense probably damaging 1.00
R4936:Nfkb1 UTSW 3 135,319,743 (GRCm39) missense probably damaging 0.97
R5085:Nfkb1 UTSW 3 135,309,568 (GRCm39) missense probably benign 0.36
R5262:Nfkb1 UTSW 3 135,318,173 (GRCm39) critical splice donor site probably null
R5384:Nfkb1 UTSW 3 135,318,303 (GRCm39) missense possibly damaging 0.95
R5385:Nfkb1 UTSW 3 135,318,303 (GRCm39) missense possibly damaging 0.95
R5434:Nfkb1 UTSW 3 135,332,372 (GRCm39) nonsense probably null
R5663:Nfkb1 UTSW 3 135,309,612 (GRCm39) missense possibly damaging 0.88
R5865:Nfkb1 UTSW 3 135,309,541 (GRCm39) missense probably damaging 1.00
R6006:Nfkb1 UTSW 3 135,309,522 (GRCm39) nonsense probably null
R6013:Nfkb1 UTSW 3 135,332,445 (GRCm39) missense possibly damaging 0.86
R6234:Nfkb1 UTSW 3 135,332,471 (GRCm39) missense possibly damaging 0.72
R6785:Nfkb1 UTSW 3 135,321,064 (GRCm39) missense probably benign
R7175:Nfkb1 UTSW 3 135,319,751 (GRCm39) missense probably damaging 1.00
R7227:Nfkb1 UTSW 3 135,332,420 (GRCm39) missense probably damaging 1.00
R7394:Nfkb1 UTSW 3 135,319,458 (GRCm39) missense possibly damaging 0.54
R7815:Nfkb1 UTSW 3 135,309,552 (GRCm39) missense probably damaging 1.00
R7849:Nfkb1 UTSW 3 135,291,173 (GRCm39) missense
R8004:Nfkb1 UTSW 3 135,297,312 (GRCm39) splice site probably benign
R8059:Nfkb1 UTSW 3 135,299,613 (GRCm39) missense possibly damaging 0.54
R8806:Nfkb1 UTSW 3 135,295,213 (GRCm39) missense probably damaging 1.00
R9169:Nfkb1 UTSW 3 135,310,874 (GRCm39) missense probably benign 0.00
X0050:Nfkb1 UTSW 3 135,312,384 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TGCGTGGCAACTACATTTCATTTC -3'
(R):5'- AACAAAGCCCTTGCCATGG -3'

Sequencing Primer
(F):5'- CCTTGAATGAAATCGAGTGACCCTG -3'
(R):5'- TGCCATGGCCTAACTCAGC -3'
Posted On 2019-11-12