Incidental Mutation 'R7727:Wdr31'
ID 595547
Institutional Source Beutler Lab
Gene Symbol Wdr31
Ensembl Gene ENSMUSG00000028391
Gene Name WD repeat domain 31
Synonyms 5430402I10Rik
MMRRC Submission 045783-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.078) question?
Stock # R7727 (G1)
Quality Score 225.009
Status Validated
Chromosome 4
Chromosomal Location 62366890-62389133 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 62378873 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 118 (F118Y)
Ref Sequence ENSEMBL: ENSMUSP00000030087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030087] [ENSMUST00000107452] [ENSMUST00000120095] [ENSMUST00000132263] [ENSMUST00000135811] [ENSMUST00000155522]
AlphaFold Q9JHB4
Predicted Effect probably damaging
Transcript: ENSMUST00000030087
AA Change: F118Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030087
Gene: ENSMUSG00000028391
AA Change: F118Y

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107452
AA Change: F117Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103076
Gene: ENSMUSG00000028391
AA Change: F117Y

DomainStartEndE-ValueType
WD40 50 88 8.88e0 SMART
WD40 91 130 6.38e-7 SMART
WD40 134 173 2.82e-8 SMART
WD40 176 215 5.31e-4 SMART
Blast:WD40 218 262 2e-10 BLAST
WD40 266 309 1.03e-1 SMART
Blast:WD40 312 351 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120095
AA Change: F118Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112719
Gene: ENSMUSG00000028391
AA Change: F118Y

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132263
SMART Domains Protein: ENSMUSP00000120684
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 16 55 5.31e-4 SMART
Blast:WD40 58 100 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135811
Predicted Effect probably benign
Transcript: ENSMUST00000155522
SMART Domains Protein: ENSMUSP00000123624
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
Blast:WD40 51 83 3e-16 BLAST
Meta Mutation Damage Score 0.6996 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A T 16: 85,696,854 (GRCm39) L101Q probably damaging Het
Arhgap18 A T 10: 26,746,007 (GRCm39) I293F possibly damaging Het
Atp8b1 T A 18: 64,678,346 (GRCm39) Q850L probably damaging Het
B4galnt3 A T 6: 120,202,148 (GRCm39) F118Y probably benign Het
Bcl6 A G 16: 23,790,163 (GRCm39) probably null Het
Cc2d2b T A 19: 40,744,974 (GRCm39) L31Q probably benign Het
Cd5l G T 3: 87,275,162 (GRCm39) E234* probably null Het
Cemip2 C T 19: 21,807,321 (GRCm39) L917F probably benign Het
Cfap65 T C 1: 74,965,784 (GRCm39) T409A probably benign Het
Chst5 A T 8: 112,617,557 (GRCm39) I21N probably benign Het
Cldn20 T C 17: 3,583,030 (GRCm39) Y68H probably benign Het
Col4a4 T C 1: 82,506,514 (GRCm39) M269V unknown Het
Dgkh A G 14: 78,832,585 (GRCm39) probably null Het
Dpp6 A G 5: 27,656,242 (GRCm39) T166A probably benign Het
Drosha A G 15: 12,881,731 (GRCm39) D754G probably damaging Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Fsd1 T G 17: 56,295,150 (GRCm39) D46E probably benign Het
Gabra1 T C 11: 42,024,418 (GRCm39) D419G probably damaging Het
Golga4 T A 9: 118,377,770 (GRCm39) D458E probably damaging Het
Grm6 C A 11: 50,742,369 (GRCm39) A134E probably benign Het
Ikzf1 T A 11: 11,698,339 (GRCm39) S63R probably damaging Het
Ilvbl G A 10: 78,412,500 (GRCm39) V74I probably benign Het
Kcng2 C T 18: 80,339,305 (GRCm39) V328M probably benign Het
Kpna7 T C 5: 144,941,855 (GRCm39) E145G probably benign Het
Krt81 A G 15: 101,357,448 (GRCm39) V428A probably damaging Het
Lalba T C 15: 98,380,549 (GRCm39) M2V probably benign Het
Lrpprc T C 17: 85,084,375 (GRCm39) S113G probably benign Het
Mboat1 A C 13: 30,410,289 (GRCm39) M249L probably benign Het
Meltf T C 16: 31,702,612 (GRCm39) V113A probably damaging Het
Muc16 T A 9: 18,571,538 (GRCm39) H327L unknown Het
Myh1 A G 11: 67,106,748 (GRCm39) I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Naga C A 15: 82,214,348 (GRCm39) V388L probably benign Het
Nfkb1 A C 3: 135,291,162 (GRCm39) M957R possibly damaging Het
Nol12 C A 15: 78,824,793 (GRCm39) S157* probably null Het
Or13c25 A G 4: 52,911,368 (GRCm39) V142A possibly damaging Het
Or5g23 A G 2: 85,438,751 (GRCm39) F168L possibly damaging Het
Or8u3-ps A T 2: 85,952,840 (GRCm39) D191V possibly damaging Het
Pcdhga5 T C 18: 37,828,098 (GRCm39) V182A probably benign Het
Pik3r4 A G 9: 105,547,081 (GRCm39) E953G probably damaging Het
Piwil2 C T 14: 70,631,506 (GRCm39) R646Q probably damaging Het
Plxnc1 T C 10: 94,779,971 (GRCm39) H157R probably damaging Het
Prrg4 A T 2: 104,669,723 (GRCm39) F131L probably benign Het
Prss3b C A 6: 41,010,127 (GRCm39) R69L probably benign Het
Rab28 A G 5: 41,865,313 (GRCm39) S4P probably damaging Het
Ranbp2 C A 10: 58,291,260 (GRCm39) Q209K probably benign Het
Schip1 G A 3: 67,972,317 (GRCm39) D15N probably benign Het
Serpina3f T G 12: 104,184,477 (GRCm39) M207R probably benign Het
Sgsm1 A T 5: 113,422,193 (GRCm39) M487K possibly damaging Het
Sh3tc2 A T 18: 62,122,651 (GRCm39) I471F probably benign Het
Slamf1 G A 1: 171,602,467 (GRCm39) V65I possibly damaging Het
Slit3 T C 11: 35,574,871 (GRCm39) C1062R probably damaging Het
Snapc4 T G 2: 26,263,446 (GRCm39) K344N probably damaging Het
Sorl1 A G 9: 41,895,822 (GRCm39) Y1778H probably damaging Het
Spon2 G A 5: 33,373,019 (GRCm39) R228C probably damaging Het
Sv2c A G 13: 96,113,203 (GRCm39) I582T possibly damaging Het
Tamm41 C T 6: 114,993,139 (GRCm39) V205M probably damaging Het
Trpm2 T C 10: 77,761,623 (GRCm39) D1009G probably benign Het
Trpm6 T C 19: 18,831,613 (GRCm39) S1493P probably damaging Het
Ttc34 G A 4: 154,923,731 (GRCm39) V147I possibly damaging Het
Tut7 A G 13: 59,947,496 (GRCm39) F942L probably benign Het
Uba2 C T 7: 33,850,275 (GRCm39) A393T probably damaging Het
Ubn2 T A 6: 38,440,873 (GRCm39) N416K probably benign Het
Uevld T C 7: 46,593,553 (GRCm39) N233S probably benign Het
Upp2 G A 2: 58,664,160 (GRCm39) M142I possibly damaging Het
Vps52 T A 17: 34,181,108 (GRCm39) V450D probably benign Het
Zfp110 T A 7: 12,582,922 (GRCm39) D523E possibly damaging Het
Zfp367 A T 13: 64,293,457 (GRCm39) V143D probably damaging Het
Zfp950 T C 19: 61,108,379 (GRCm39) I235V probably benign Het
Other mutations in Wdr31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Wdr31 APN 4 62,375,757 (GRCm39) missense probably damaging 1.00
IGL01315:Wdr31 APN 4 62,374,074 (GRCm39) missense probably damaging 1.00
IGL02345:Wdr31 APN 4 62,377,083 (GRCm39) missense possibly damaging 0.89
IGL03192:Wdr31 APN 4 62,372,149 (GRCm39) missense possibly damaging 0.73
R0045:Wdr31 UTSW 4 62,382,270 (GRCm39) missense possibly damaging 0.81
R0257:Wdr31 UTSW 4 62,378,755 (GRCm39) critical splice donor site probably null
R0486:Wdr31 UTSW 4 62,372,130 (GRCm39) missense probably damaging 1.00
R1983:Wdr31 UTSW 4 62,378,840 (GRCm39) missense probably damaging 1.00
R2081:Wdr31 UTSW 4 62,374,180 (GRCm39) missense probably benign 0.00
R3620:Wdr31 UTSW 4 62,375,701 (GRCm39) missense possibly damaging 0.95
R4256:Wdr31 UTSW 4 62,375,675 (GRCm39) critical splice donor site probably null
R4303:Wdr31 UTSW 4 62,378,626 (GRCm39) missense probably damaging 1.00
R4562:Wdr31 UTSW 4 62,372,159 (GRCm39) missense probably damaging 1.00
R5747:Wdr31 UTSW 4 62,381,637 (GRCm39) missense probably damaging 0.98
R5986:Wdr31 UTSW 4 62,374,113 (GRCm39) missense probably benign 0.02
R6170:Wdr31 UTSW 4 62,381,661 (GRCm39) missense probably damaging 1.00
R6887:Wdr31 UTSW 4 62,375,802 (GRCm39) missense probably benign 0.03
R7126:Wdr31 UTSW 4 62,381,666 (GRCm39) missense probably benign 0.00
R7469:Wdr31 UTSW 4 62,375,768 (GRCm39) missense probably damaging 0.99
R7653:Wdr31 UTSW 4 62,381,666 (GRCm39) missense probably benign 0.00
R8255:Wdr31 UTSW 4 62,381,634 (GRCm39) missense probably benign 0.00
R8704:Wdr31 UTSW 4 62,380,442 (GRCm39) missense probably benign
R9798:Wdr31 UTSW 4 62,381,651 (GRCm39) missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCATAAGTTGGGATGTGGAC -3'
(R):5'- CTCAAATGTGCACACAGGGG -3'

Sequencing Primer
(F):5'- ACAGGGTTCTGGGAATGCACC -3'
(R):5'- CATTACGGATGGTTGTAAGCCACC -3'
Posted On 2019-11-12