Incidental Mutation 'R7727:Wdr31'
ID595547
Institutional Source Beutler Lab
Gene Symbol Wdr31
Ensembl Gene ENSMUSG00000028391
Gene NameWD repeat domain 31
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.092) question?
Stock #R7727 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location62448653-62470896 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 62460636 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 118 (F118Y)
Ref Sequence ENSEMBL: ENSMUSP00000030087 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030087] [ENSMUST00000107452] [ENSMUST00000120095] [ENSMUST00000132263] [ENSMUST00000135811] [ENSMUST00000155522]
Predicted Effect probably damaging
Transcript: ENSMUST00000030087
AA Change: F118Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000030087
Gene: ENSMUSG00000028391
AA Change: F118Y

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000107452
AA Change: F117Y

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000103076
Gene: ENSMUSG00000028391
AA Change: F117Y

DomainStartEndE-ValueType
WD40 50 88 8.88e0 SMART
WD40 91 130 6.38e-7 SMART
WD40 134 173 2.82e-8 SMART
WD40 176 215 5.31e-4 SMART
Blast:WD40 218 262 2e-10 BLAST
WD40 266 309 1.03e-1 SMART
Blast:WD40 312 351 2e-15 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000120095
AA Change: F118Y

PolyPhen 2 Score 0.985 (Sensitivity: 0.74; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000112719
Gene: ENSMUSG00000028391
AA Change: F118Y

DomainStartEndE-ValueType
WD40 51 89 8.88e0 SMART
WD40 92 131 6.38e-7 SMART
WD40 135 174 2.82e-8 SMART
WD40 177 216 5.31e-4 SMART
Blast:WD40 219 263 2e-10 BLAST
WD40 267 310 1.03e-1 SMART
Blast:WD40 313 352 2e-15 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000132263
SMART Domains Protein: ENSMUSP00000120684
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
WD40 16 55 5.31e-4 SMART
Blast:WD40 58 100 3e-9 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000135811
Predicted Effect probably benign
Transcript: ENSMUST00000155522
SMART Domains Protein: ENSMUSP00000123624
Gene: ENSMUSG00000028391

DomainStartEndE-ValueType
Blast:WD40 51 83 3e-16 BLAST
Meta Mutation Damage Score 0.6996 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the WD repeat protein family. WD repeats are minimally conserved regions of approximately 40 amino acids typically bracketed by gly-his and trp-asp (GH-WD), which may facilitate formation of heterotrimeric or multiprotein complexes. Members of this family are involved in a variety of cellular processes, including cell cycle progression, signal transduction, apoptosis, and gene regulation. Multiple alternatively spliced transcript variants encoding distinct isoforms have been found for this gene but the biological validity of some variants has not been determined. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Adamts5 A T 16: 85,899,966 L101Q probably damaging Het
Arhgap18 A T 10: 26,870,011 I293F possibly damaging Het
Atp8b1 T A 18: 64,545,275 Q850L probably damaging Het
B4galnt3 A T 6: 120,225,187 F118Y probably benign Het
Bcl6 A G 16: 23,971,413 probably null Het
Cc2d2b T A 19: 40,756,530 L31Q probably benign Het
Cd5l G T 3: 87,367,855 E234* probably null Het
Cfap65 T C 1: 74,926,625 T409A probably benign Het
Chst5 A T 8: 111,890,925 I21N probably benign Het
Cldn20 T C 17: 3,532,755 Y68H probably benign Het
Col4a4 T C 1: 82,528,793 M269V unknown Het
Dgkh A G 14: 78,595,145 probably null Het
Dpp6 A G 5: 27,451,244 T166A probably benign Het
Drosha A G 15: 12,881,645 D754G probably damaging Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Fsd1 T G 17: 55,988,150 D46E probably benign Het
Gabra1 T C 11: 42,133,591 D419G probably damaging Het
Golga4 T A 9: 118,548,702 D458E probably damaging Het
Grm6 C A 11: 50,851,542 A134E probably benign Het
Ikzf1 T A 11: 11,748,339 S63R probably damaging Het
Ilvbl G A 10: 78,576,666 V74I probably benign Het
Kcng2 C T 18: 80,296,090 V328M probably benign Het
Kpna7 T C 5: 145,005,045 E145G probably benign Het
Krt81 A G 15: 101,459,567 V428A probably damaging Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lrpprc T C 17: 84,776,947 S113G probably benign Het
Mboat1 A C 13: 30,226,306 M249L probably benign Het
Meltf T C 16: 31,883,794 V113A probably damaging Het
Muc16 T A 9: 18,660,242 H327L unknown Het
Myh1 A G 11: 67,215,922 I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Naga C A 15: 82,330,147 V388L probably benign Het
Nfkb1 A C 3: 135,585,401 M957R possibly damaging Het
Nol12 C A 15: 78,940,593 S157* probably null Het
Olfr1000 A G 2: 85,608,407 F168L possibly damaging Het
Olfr1038-ps A T 2: 86,122,496 D191V possibly damaging Het
Olfr272 A G 4: 52,911,368 V142A possibly damaging Het
Pcdhga5 T C 18: 37,695,045 V182A probably benign Het
Pik3r4 A G 9: 105,669,882 E953G probably damaging Het
Piwil2 C T 14: 70,394,057 R646Q probably damaging Het
Plxnc1 T C 10: 94,944,109 H157R probably damaging Het
Prrg4 A T 2: 104,839,378 F131L probably benign Het
Rab28 A G 5: 41,707,970 S4P probably damaging Het
Ranbp2 C A 10: 58,455,438 Q209K probably benign Het
Schip1 G A 3: 68,064,984 D15N probably benign Het
Serpina3f T G 12: 104,218,218 M207R probably benign Het
Sgsm1 A T 5: 113,274,327 M487K possibly damaging Het
Sh3tc2 A T 18: 61,989,580 I471F probably benign Het
Slamf1 G A 1: 171,774,899 V65I possibly damaging Het
Slit3 T C 11: 35,684,044 C1062R probably damaging Het
Snapc4 T G 2: 26,373,434 K344N probably damaging Het
Sorl1 A G 9: 41,984,526 Y1778H probably damaging Het
Spon2 G A 5: 33,215,675 R228C probably damaging Het
Sv2c A G 13: 95,976,695 I582T possibly damaging Het
Tamm41 C T 6: 115,016,178 V205M probably damaging Het
Tmem2 C T 19: 21,829,957 L917F probably benign Het
Trpm2 T C 10: 77,925,789 D1009G probably benign Het
Trpm6 T C 19: 18,854,249 S1493P probably damaging Het
Ttc34 G A 4: 154,839,274 V147I possibly damaging Het
Uba2 C T 7: 34,150,850 A393T probably damaging Het
Ubn2 T A 6: 38,463,938 N416K probably benign Het
Uevld T C 7: 46,943,805 N233S probably benign Het
Upp2 G A 2: 58,774,148 M142I possibly damaging Het
Vps52 T A 17: 33,962,134 V450D probably benign Het
Zcchc6 A G 13: 59,799,682 F942L probably benign Het
Zfp110 T A 7: 12,848,995 D523E possibly damaging Het
Zfp367 A T 13: 64,145,643 V143D probably damaging Het
Zfp950 T C 19: 61,119,941 I235V probably benign Het
Other mutations in Wdr31
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00970:Wdr31 APN 4 62457520 missense probably damaging 1.00
IGL01315:Wdr31 APN 4 62455837 missense probably damaging 1.00
IGL02345:Wdr31 APN 4 62458846 missense possibly damaging 0.89
IGL03192:Wdr31 APN 4 62453912 missense possibly damaging 0.73
R0045:Wdr31 UTSW 4 62464033 missense possibly damaging 0.81
R0257:Wdr31 UTSW 4 62460518 critical splice donor site probably null
R0486:Wdr31 UTSW 4 62453893 missense probably damaging 1.00
R1983:Wdr31 UTSW 4 62460603 missense probably damaging 1.00
R2081:Wdr31 UTSW 4 62455943 missense probably benign 0.00
R3620:Wdr31 UTSW 4 62457464 missense possibly damaging 0.95
R4256:Wdr31 UTSW 4 62457438 critical splice donor site probably null
R4303:Wdr31 UTSW 4 62460389 missense probably damaging 1.00
R4562:Wdr31 UTSW 4 62453922 missense probably damaging 1.00
R5747:Wdr31 UTSW 4 62463400 missense probably damaging 0.98
R5986:Wdr31 UTSW 4 62455876 missense probably benign 0.02
R6170:Wdr31 UTSW 4 62463424 missense probably damaging 1.00
R6887:Wdr31 UTSW 4 62457565 missense probably benign 0.03
R7126:Wdr31 UTSW 4 62463429 missense probably benign 0.00
R7469:Wdr31 UTSW 4 62457531 missense probably damaging 0.99
R7653:Wdr31 UTSW 4 62463429 missense probably benign 0.00
R8255:Wdr31 UTSW 4 62463397 missense probably benign 0.00
R8704:Wdr31 UTSW 4 62462205 missense probably benign
Predicted Primers PCR Primer
(F):5'- GCCATAAGTTGGGATGTGGAC -3'
(R):5'- CTCAAATGTGCACACAGGGG -3'

Sequencing Primer
(F):5'- ACAGGGTTCTGGGAATGCACC -3'
(R):5'- CATTACGGATGGTTGTAAGCCACC -3'
Posted On2019-11-12