Incidental Mutation 'R7727:Sgsm1'
ID 595552
Institutional Source Beutler Lab
Gene Symbol Sgsm1
Ensembl Gene ENSMUSG00000042216
Gene Name small G protein signaling modulator 1
Synonyms Rutbc2, 2410098H20Rik, D5Bwg1524e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock # R7727 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 113243220-113310786 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) A to T at 113274327 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Methionine to Lysine at position 487 (M487K)
Ref Sequence ENSEMBL: ENSMUSP00000046544 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048112] [ENSMUST00000057209] [ENSMUST00000112324] [ENSMUST00000112325] [ENSMUST00000154248]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000048112
AA Change: M487K

PolyPhen 2 Score 0.947 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000046544
Gene: ENSMUSG00000042216
AA Change: M487K

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
TBC 559 1053 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000057209
AA Change: M200K

PolyPhen 2 Score 0.992 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000084106
Gene: ENSMUSG00000042216
AA Change: M200K

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
TBC 272 766 2.88e-29 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000112324
AA Change: M200K

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000107943
Gene: ENSMUSG00000042216
AA Change: M200K

DomainStartEndE-ValueType
low complexity region 114 126 N/A INTRINSIC
low complexity region 167 182 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000112325
AA Change: M487K

PolyPhen 2 Score 0.945 (Sensitivity: 0.80; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000107944
Gene: ENSMUSG00000042216
AA Change: M487K

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 454 469 N/A INTRINSIC
SCOP:d1fkma1 539 615 1e-6 SMART
Blast:TBC 559 675 1e-71 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000154248
AA Change: M542K

PolyPhen 2 Score 0.981 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000114932
Gene: ENSMUSG00000042216
AA Change: M542K

DomainStartEndE-ValueType
RUN 127 187 6.52e-18 SMART
low complexity region 401 413 N/A INTRINSIC
low complexity region 509 524 N/A INTRINSIC
SCOP:d1fkma1 594 670 9e-7 SMART
Blast:TBC 614 706 3e-55 BLAST
Meta Mutation Damage Score 0.8472 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Adamts5 A T 16: 85,899,966 L101Q probably damaging Het
Arhgap18 A T 10: 26,870,011 I293F possibly damaging Het
Atp8b1 T A 18: 64,545,275 Q850L probably damaging Het
B4galnt3 A T 6: 120,225,187 F118Y probably benign Het
Bcl6 A G 16: 23,971,413 probably null Het
Cc2d2b T A 19: 40,756,530 L31Q probably benign Het
Cd5l G T 3: 87,367,855 E234* probably null Het
Cfap65 T C 1: 74,926,625 T409A probably benign Het
Chst5 A T 8: 111,890,925 I21N probably benign Het
Cldn20 T C 17: 3,532,755 Y68H probably benign Het
Col4a4 T C 1: 82,528,793 M269V unknown Het
Dgkh A G 14: 78,595,145 probably null Het
Dpp6 A G 5: 27,451,244 T166A probably benign Het
Drosha A G 15: 12,881,645 D754G probably damaging Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Fsd1 T G 17: 55,988,150 D46E probably benign Het
Gabra1 T C 11: 42,133,591 D419G probably damaging Het
Golga4 T A 9: 118,548,702 D458E probably damaging Het
Grm6 C A 11: 50,851,542 A134E probably benign Het
Ikzf1 T A 11: 11,748,339 S63R probably damaging Het
Ilvbl G A 10: 78,576,666 V74I probably benign Het
Kcng2 C T 18: 80,296,090 V328M probably benign Het
Kpna7 T C 5: 145,005,045 E145G probably benign Het
Krt81 A G 15: 101,459,567 V428A probably damaging Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lrpprc T C 17: 84,776,947 S113G probably benign Het
Mboat1 A C 13: 30,226,306 M249L probably benign Het
Meltf T C 16: 31,883,794 V113A probably damaging Het
Muc16 T A 9: 18,660,242 H327L unknown Het
Myh1 A G 11: 67,215,922 I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Naga C A 15: 82,330,147 V388L probably benign Het
Nfkb1 A C 3: 135,585,401 M957R possibly damaging Het
Nol12 C A 15: 78,940,593 S157* probably null Het
Olfr1000 A G 2: 85,608,407 F168L possibly damaging Het
Olfr1038-ps A T 2: 86,122,496 D191V possibly damaging Het
Olfr272 A G 4: 52,911,368 V142A possibly damaging Het
Pcdhga5 T C 18: 37,695,045 V182A probably benign Het
Pik3r4 A G 9: 105,669,882 E953G probably damaging Het
Piwil2 C T 14: 70,394,057 R646Q probably damaging Het
Plxnc1 T C 10: 94,944,109 H157R probably damaging Het
Prrg4 A T 2: 104,839,378 F131L probably benign Het
Rab28 A G 5: 41,707,970 S4P probably damaging Het
Ranbp2 C A 10: 58,455,438 Q209K probably benign Het
Schip1 G A 3: 68,064,984 D15N probably benign Het
Serpina3f T G 12: 104,218,218 M207R probably benign Het
Sh3tc2 A T 18: 61,989,580 I471F probably benign Het
Slamf1 G A 1: 171,774,899 V65I possibly damaging Het
Slit3 T C 11: 35,684,044 C1062R probably damaging Het
Snapc4 T G 2: 26,373,434 K344N probably damaging Het
Sorl1 A G 9: 41,984,526 Y1778H probably damaging Het
Spon2 G A 5: 33,215,675 R228C probably damaging Het
Sv2c A G 13: 95,976,695 I582T possibly damaging Het
Tamm41 C T 6: 115,016,178 V205M probably damaging Het
Tmem2 C T 19: 21,829,957 L917F probably benign Het
Trpm2 T C 10: 77,925,789 D1009G probably benign Het
Trpm6 T C 19: 18,854,249 S1493P probably damaging Het
Ttc34 G A 4: 154,839,274 V147I possibly damaging Het
Uba2 C T 7: 34,150,850 A393T probably damaging Het
Ubn2 T A 6: 38,463,938 N416K probably benign Het
Uevld T C 7: 46,943,805 N233S probably benign Het
Upp2 G A 2: 58,774,148 M142I possibly damaging Het
Vps52 T A 17: 33,962,134 V450D probably benign Het
Wdr31 A T 4: 62,460,636 F118Y probably damaging Het
Zcchc6 A G 13: 59,799,682 F942L probably benign Het
Zfp110 T A 7: 12,848,995 D523E possibly damaging Het
Zfp367 A T 13: 64,145,643 V143D probably damaging Het
Zfp950 T C 19: 61,119,941 I235V probably benign Het
Other mutations in Sgsm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00230:Sgsm1 APN 5 113245064 missense probably benign 0.00
IGL00503:Sgsm1 APN 5 113276142 missense probably benign 0.00
IGL01377:Sgsm1 APN 5 113276182 splice site probably benign
IGL01602:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01605:Sgsm1 APN 5 113285665 missense possibly damaging 0.92
IGL01669:Sgsm1 APN 5 113263490 missense probably benign
IGL01920:Sgsm1 APN 5 113273605 missense probably damaging 1.00
IGL01951:Sgsm1 APN 5 113286767 splice site probably benign
IGL02387:Sgsm1 APN 5 113253063 missense possibly damaging 0.93
IGL02690:Sgsm1 APN 5 113286767 splice site probably benign
IGL03177:Sgsm1 APN 5 113250993 missense probably damaging 1.00
IGL03186:Sgsm1 APN 5 113285021 missense probably benign 0.00
IGL03398:Sgsm1 APN 5 113255316 missense possibly damaging 0.67
caliente UTSW 5 113280462 intron probably benign
Chili UTSW 5 113258123 intron probably benign
pimiento UTSW 5 113263257 missense probably benign 0.15
R0048:Sgsm1 UTSW 5 113268750 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0058:Sgsm1 UTSW 5 113285087 missense probably damaging 1.00
R0082:Sgsm1 UTSW 5 113288836 missense probably benign 0.01
R0085:Sgsm1 UTSW 5 113279270 splice site probably benign
R0099:Sgsm1 UTSW 5 113274360 splice site probably benign
R0269:Sgsm1 UTSW 5 113286929 critical splice acceptor site probably null
R0310:Sgsm1 UTSW 5 113263705 missense probably benign 0.00
R0325:Sgsm1 UTSW 5 113288835 missense probably damaging 0.99
R0420:Sgsm1 UTSW 5 113263759 missense probably benign 0.16
R0594:Sgsm1 UTSW 5 113310562 missense probably benign 0.00
R0599:Sgsm1 UTSW 5 113245028 missense probably damaging 1.00
R0631:Sgsm1 UTSW 5 113285123 splice site probably benign
R0744:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0833:Sgsm1 UTSW 5 113279184 missense probably benign 0.38
R0919:Sgsm1 UTSW 5 113258842 missense probably damaging 1.00
R0944:Sgsm1 UTSW 5 113265874 missense probably benign 0.40
R1169:Sgsm1 UTSW 5 113279485 missense probably damaging 1.00
R1232:Sgsm1 UTSW 5 113273711 nonsense probably null
R1473:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R1535:Sgsm1 UTSW 5 113263269 missense possibly damaging 0.93
R1796:Sgsm1 UTSW 5 113273617 missense possibly damaging 0.58
R1878:Sgsm1 UTSW 5 113263515 missense probably damaging 0.97
R2084:Sgsm1 UTSW 5 113285400 missense probably damaging 1.00
R3855:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R3856:Sgsm1 UTSW 5 113263259 missense probably benign 0.01
R4294:Sgsm1 UTSW 5 113285404 missense probably damaging 1.00
R4373:Sgsm1 UTSW 5 113258123 intron probably benign
R4558:Sgsm1 UTSW 5 113258111 intron probably benign
R4610:Sgsm1 UTSW 5 113255307 missense probably damaging 1.00
R4667:Sgsm1 UTSW 5 113260047 critical splice donor site probably null
R4838:Sgsm1 UTSW 5 113282626 missense probably damaging 1.00
R4890:Sgsm1 UTSW 5 113280462 intron probably benign
R4992:Sgsm1 UTSW 5 113282620 missense possibly damaging 0.89
R5366:Sgsm1 UTSW 5 113251039 missense possibly damaging 0.91
R5776:Sgsm1 UTSW 5 113250957 missense probably damaging 1.00
R5813:Sgsm1 UTSW 5 113250956 missense probably damaging 1.00
R6000:Sgsm1 UTSW 5 113286838 missense probably damaging 1.00
R6354:Sgsm1 UTSW 5 113282656 missense probably damaging 0.99
R6440:Sgsm1 UTSW 5 113279131 critical splice donor site probably null
R6831:Sgsm1 UTSW 5 113280380 missense probably damaging 0.97
R7307:Sgsm1 UTSW 5 113273646 missense probably benign 0.00
R7309:Sgsm1 UTSW 5 113268846 splice site probably null
R7387:Sgsm1 UTSW 5 113263700 missense probably damaging 1.00
R7439:Sgsm1 UTSW 5 113274321 missense probably damaging 0.99
R7485:Sgsm1 UTSW 5 113279635 splice site probably null
R7624:Sgsm1 UTSW 5 113274335 nonsense probably null
R7632:Sgsm1 UTSW 5 113276082 missense possibly damaging 0.54
R7669:Sgsm1 UTSW 5 113253024 missense probably damaging 1.00
R7732:Sgsm1 UTSW 5 113266330 missense probably benign 0.26
R7961:Sgsm1 UTSW 5 113282644 missense probably damaging 1.00
R8088:Sgsm1 UTSW 5 113255268 missense probably damaging 1.00
R8213:Sgsm1 UTSW 5 113251011 missense probably damaging 1.00
R8278:Sgsm1 UTSW 5 113260092 missense probably damaging 0.98
R8480:Sgsm1 UTSW 5 113263418 missense probably benign 0.01
R8796:Sgsm1 UTSW 5 113263257 missense probably benign 0.15
R8816:Sgsm1 UTSW 5 113287231 missense probably damaging 1.00
R8904:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8905:Sgsm1 UTSW 5 113273629 missense probably benign 0.00
R8952:Sgsm1 UTSW 5 113284995 missense probably damaging 1.00
R9046:Sgsm1 UTSW 5 113288859 missense probably damaging 1.00
R9162:Sgsm1 UTSW 5 113282711 missense probably damaging 1.00
R9249:Sgsm1 UTSW 5 113280335 missense possibly damaging 0.86
R9375:Sgsm1 UTSW 5 113274273 missense unknown
R9377:Sgsm1 UTSW 5 113288875 missense probably damaging 1.00
R9461:Sgsm1 UTSW 5 113276032 critical splice donor site probably null
R9662:Sgsm1 UTSW 5 113279231 missense probably benign 0.03
R9722:Sgsm1 UTSW 5 113280341 missense possibly damaging 0.75
R9726:Sgsm1 UTSW 5 113310552 missense probably benign
Z1177:Sgsm1 UTSW 5 113282710 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AGCTAGTCCTGTCCCCTCAAAG -3'
(R):5'- CACAACGCTATGAATGGCTGATC -3'

Sequencing Primer
(F):5'- TCCTGTCCCCTCAAAGGAGTG -3'
(R):5'- CCAACAGAAACCTGGGCTGTG -3'
Posted On 2019-11-12