Incidental Mutation 'R7727:Tamm41'
ID 595556
Institutional Source Beutler Lab
Gene Symbol Tamm41
Ensembl Gene ENSMUSG00000030316
Gene Name TAM41 mitochondrial translocator assembly and maintenance homolog
Synonyms 1500001M20Rik
MMRRC Submission 045783-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.942) question?
Stock # R7727 (G1)
Quality Score 225.009
Status Validated
Chromosome 6
Chromosomal Location 114981342-115014837 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 114993139 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 205 (V205M)
Ref Sequence ENSEMBL: ENSMUSP00000032461 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000032461] [ENSMUST00000154621] [ENSMUST00000172495] [ENSMUST00000174848]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000032461
AA Change: V205M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000032461
Gene: ENSMUSG00000030316
AA Change: V205M

DomainStartEndE-ValueType
Pfam:Mmp37 13 327 9.9e-115 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000154621
SMART Domains Protein: ENSMUSP00000116995
Gene: ENSMUSG00000030316

DomainStartEndE-ValueType
Pfam:Mmp37 12 109 8.6e-40 PFAM
low complexity region 130 148 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000172495
AA Change: V83M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000134105
Gene: ENSMUSG00000030316
AA Change: V83M

DomainStartEndE-ValueType
Pfam:Mmp37 1 124 2.4e-47 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000174848
SMART Domains Protein: ENSMUSP00000133340
Gene: ENSMUSG00000030316

DomainStartEndE-ValueType
Pfam:Mmp37 12 188 3.2e-79 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype PHENOTYPE: Mice homozygous for a knock-out allele exhibit embryonic lethality. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A T 16: 85,696,854 (GRCm39) L101Q probably damaging Het
Arhgap18 A T 10: 26,746,007 (GRCm39) I293F possibly damaging Het
Atp8b1 T A 18: 64,678,346 (GRCm39) Q850L probably damaging Het
B4galnt3 A T 6: 120,202,148 (GRCm39) F118Y probably benign Het
Bcl6 A G 16: 23,790,163 (GRCm39) probably null Het
Cc2d2b T A 19: 40,744,974 (GRCm39) L31Q probably benign Het
Cd5l G T 3: 87,275,162 (GRCm39) E234* probably null Het
Cemip2 C T 19: 21,807,321 (GRCm39) L917F probably benign Het
Cfap65 T C 1: 74,965,784 (GRCm39) T409A probably benign Het
Chst5 A T 8: 112,617,557 (GRCm39) I21N probably benign Het
Cldn20 T C 17: 3,583,030 (GRCm39) Y68H probably benign Het
Col4a4 T C 1: 82,506,514 (GRCm39) M269V unknown Het
Dgkh A G 14: 78,832,585 (GRCm39) probably null Het
Dpp6 A G 5: 27,656,242 (GRCm39) T166A probably benign Het
Drosha A G 15: 12,881,731 (GRCm39) D754G probably damaging Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Fsd1 T G 17: 56,295,150 (GRCm39) D46E probably benign Het
Gabra1 T C 11: 42,024,418 (GRCm39) D419G probably damaging Het
Golga4 T A 9: 118,377,770 (GRCm39) D458E probably damaging Het
Grm6 C A 11: 50,742,369 (GRCm39) A134E probably benign Het
Ikzf1 T A 11: 11,698,339 (GRCm39) S63R probably damaging Het
Ilvbl G A 10: 78,412,500 (GRCm39) V74I probably benign Het
Kcng2 C T 18: 80,339,305 (GRCm39) V328M probably benign Het
Kpna7 T C 5: 144,941,855 (GRCm39) E145G probably benign Het
Krt81 A G 15: 101,357,448 (GRCm39) V428A probably damaging Het
Lalba T C 15: 98,380,549 (GRCm39) M2V probably benign Het
Lrpprc T C 17: 85,084,375 (GRCm39) S113G probably benign Het
Mboat1 A C 13: 30,410,289 (GRCm39) M249L probably benign Het
Meltf T C 16: 31,702,612 (GRCm39) V113A probably damaging Het
Muc16 T A 9: 18,571,538 (GRCm39) H327L unknown Het
Myh1 A G 11: 67,106,748 (GRCm39) I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Naga C A 15: 82,214,348 (GRCm39) V388L probably benign Het
Nfkb1 A C 3: 135,291,162 (GRCm39) M957R possibly damaging Het
Nol12 C A 15: 78,824,793 (GRCm39) S157* probably null Het
Or13c25 A G 4: 52,911,368 (GRCm39) V142A possibly damaging Het
Or5g23 A G 2: 85,438,751 (GRCm39) F168L possibly damaging Het
Or8u3-ps A T 2: 85,952,840 (GRCm39) D191V possibly damaging Het
Pcdhga5 T C 18: 37,828,098 (GRCm39) V182A probably benign Het
Pik3r4 A G 9: 105,547,081 (GRCm39) E953G probably damaging Het
Piwil2 C T 14: 70,631,506 (GRCm39) R646Q probably damaging Het
Plxnc1 T C 10: 94,779,971 (GRCm39) H157R probably damaging Het
Prrg4 A T 2: 104,669,723 (GRCm39) F131L probably benign Het
Prss3b C A 6: 41,010,127 (GRCm39) R69L probably benign Het
Rab28 A G 5: 41,865,313 (GRCm39) S4P probably damaging Het
Ranbp2 C A 10: 58,291,260 (GRCm39) Q209K probably benign Het
Schip1 G A 3: 67,972,317 (GRCm39) D15N probably benign Het
Serpina3f T G 12: 104,184,477 (GRCm39) M207R probably benign Het
Sgsm1 A T 5: 113,422,193 (GRCm39) M487K possibly damaging Het
Sh3tc2 A T 18: 62,122,651 (GRCm39) I471F probably benign Het
Slamf1 G A 1: 171,602,467 (GRCm39) V65I possibly damaging Het
Slit3 T C 11: 35,574,871 (GRCm39) C1062R probably damaging Het
Snapc4 T G 2: 26,263,446 (GRCm39) K344N probably damaging Het
Sorl1 A G 9: 41,895,822 (GRCm39) Y1778H probably damaging Het
Spon2 G A 5: 33,373,019 (GRCm39) R228C probably damaging Het
Sv2c A G 13: 96,113,203 (GRCm39) I582T possibly damaging Het
Trpm2 T C 10: 77,761,623 (GRCm39) D1009G probably benign Het
Trpm6 T C 19: 18,831,613 (GRCm39) S1493P probably damaging Het
Ttc34 G A 4: 154,923,731 (GRCm39) V147I possibly damaging Het
Tut7 A G 13: 59,947,496 (GRCm39) F942L probably benign Het
Uba2 C T 7: 33,850,275 (GRCm39) A393T probably damaging Het
Ubn2 T A 6: 38,440,873 (GRCm39) N416K probably benign Het
Uevld T C 7: 46,593,553 (GRCm39) N233S probably benign Het
Upp2 G A 2: 58,664,160 (GRCm39) M142I possibly damaging Het
Vps52 T A 17: 34,181,108 (GRCm39) V450D probably benign Het
Wdr31 A T 4: 62,378,873 (GRCm39) F118Y probably damaging Het
Zfp110 T A 7: 12,582,922 (GRCm39) D523E possibly damaging Het
Zfp367 A T 13: 64,293,457 (GRCm39) V143D probably damaging Het
Zfp950 T C 19: 61,108,379 (GRCm39) I235V probably benign Het
Other mutations in Tamm41
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01634:Tamm41 APN 6 114,993,059 (GRCm39) missense probably benign 0.00
R0101:Tamm41 UTSW 6 115,009,207 (GRCm39) missense probably damaging 1.00
R2045:Tamm41 UTSW 6 114,993,056 (GRCm39) missense probably benign 0.07
R4207:Tamm41 UTSW 6 114,989,320 (GRCm39) intron probably benign
R4208:Tamm41 UTSW 6 114,989,320 (GRCm39) intron probably benign
R4627:Tamm41 UTSW 6 115,011,963 (GRCm39) missense probably benign 0.18
R4820:Tamm41 UTSW 6 115,002,378 (GRCm39) missense possibly damaging 0.94
R6551:Tamm41 UTSW 6 114,989,142 (GRCm39) missense possibly damaging 0.90
R9430:Tamm41 UTSW 6 114,993,063 (GRCm39) missense probably benign
X0058:Tamm41 UTSW 6 115,011,982 (GRCm39) missense possibly damaging 0.55
Predicted Primers PCR Primer
(F):5'- GTGAGGAACGGGTTTAATTACTCC -3'
(R):5'- TTCCTCTTATACCACAAAGGCC -3'

Sequencing Primer
(F):5'- GGAACGGGTTTAATTACTCCTACTTC -3'
(R):5'- CTGGAACTCACTTTGTAGACCAGG -3'
Posted On 2019-11-12