Incidental Mutation 'R7727:Grm6'
ID 595575
Institutional Source Beutler Lab
Gene Symbol Grm6
Ensembl Gene ENSMUSG00000000617
Gene Name glutamate receptor, metabotropic 6
Synonyms nob3, mGluR6, nerg1
MMRRC Submission 045783-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7727 (G1)
Quality Score 225.009
Status Validated
Chromosome 11
Chromosomal Location 50741512-50757035 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 50742369 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Alanine to Glutamic Acid at position 134 (A134E)
Ref Sequence ENSEMBL: ENSMUSP00000000631 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000000631] [ENSMUST00000171427]
AlphaFold Q5NCH9
Predicted Effect probably benign
Transcript: ENSMUST00000000631
AA Change: A134E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000000631
Gene: ENSMUSG00000000617
AA Change: A134E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 4.1e-101 PFAM
Pfam:Peripla_BP_6 132 475 1.7e-11 PFAM
Pfam:NCD3G 508 558 5.3e-16 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 589 837 7.2e-84 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000171427
AA Change: A134E

PolyPhen 2 Score 0.021 (Sensitivity: 0.95; Specificity: 0.80)
SMART Domains Protein: ENSMUSP00000130728
Gene: ENSMUSG00000000617
AA Change: A134E

DomainStartEndE-ValueType
signal peptide 1 23 N/A INTRINSIC
Pfam:ANF_receptor 61 471 2.5e-106 PFAM
Pfam:Peripla_BP_6 132 338 6.2e-10 PFAM
Pfam:NCD3G 508 558 4e-13 PFAM
low complexity region 575 587 N/A INTRINSIC
Pfam:7tm_3 591 836 1.4e-56 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] L-glutamate is the major excitatory neurotransmitter in the central nervous system and activates both ionotropic and metabotropic glutamate receptors. Glutamatergic neurotransmission is involved in most aspects of normal brain function and can be perturbed in many neuropathologic conditions. The metabotropic glutamate receptors are a family of G protein-coupled receptors, that have been divided into 3 groups on the basis of sequence homology, putative signal transduction mechanisms, and pharmacologic properties. Group I includes GRM1 and GRM5 and these receptors have been shown to activate phospholipase C. Group II includes GRM2 and GRM3 while Group III includes GRM4, GRM6, GRM7 and GRM8. Group II and III receptors are linked to the inhibition of the cyclic AMP cascade but differ in their agonist selectivities. [provided by RefSeq, Feb 2012]
PHENOTYPE: Homozygous null mice show loss of ON responses without significant alteration of OFF responses in visual transmission or changes in visual behavioral responses. ENU-induced mutant mice have an ERG that lacks the rod b-wave and scotopic threshold response, while the cone ERG is of large amplitude. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A T 16: 85,696,854 (GRCm39) L101Q probably damaging Het
Arhgap18 A T 10: 26,746,007 (GRCm39) I293F possibly damaging Het
Atp8b1 T A 18: 64,678,346 (GRCm39) Q850L probably damaging Het
B4galnt3 A T 6: 120,202,148 (GRCm39) F118Y probably benign Het
Bcl6 A G 16: 23,790,163 (GRCm39) probably null Het
Cc2d2b T A 19: 40,744,974 (GRCm39) L31Q probably benign Het
Cd5l G T 3: 87,275,162 (GRCm39) E234* probably null Het
Cemip2 C T 19: 21,807,321 (GRCm39) L917F probably benign Het
Cfap65 T C 1: 74,965,784 (GRCm39) T409A probably benign Het
Chst5 A T 8: 112,617,557 (GRCm39) I21N probably benign Het
Cldn20 T C 17: 3,583,030 (GRCm39) Y68H probably benign Het
Col4a4 T C 1: 82,506,514 (GRCm39) M269V unknown Het
Dgkh A G 14: 78,832,585 (GRCm39) probably null Het
Dpp6 A G 5: 27,656,242 (GRCm39) T166A probably benign Het
Drosha A G 15: 12,881,731 (GRCm39) D754G probably damaging Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Fsd1 T G 17: 56,295,150 (GRCm39) D46E probably benign Het
Gabra1 T C 11: 42,024,418 (GRCm39) D419G probably damaging Het
Golga4 T A 9: 118,377,770 (GRCm39) D458E probably damaging Het
Ikzf1 T A 11: 11,698,339 (GRCm39) S63R probably damaging Het
Ilvbl G A 10: 78,412,500 (GRCm39) V74I probably benign Het
Kcng2 C T 18: 80,339,305 (GRCm39) V328M probably benign Het
Kpna7 T C 5: 144,941,855 (GRCm39) E145G probably benign Het
Krt81 A G 15: 101,357,448 (GRCm39) V428A probably damaging Het
Lalba T C 15: 98,380,549 (GRCm39) M2V probably benign Het
Lrpprc T C 17: 85,084,375 (GRCm39) S113G probably benign Het
Mboat1 A C 13: 30,410,289 (GRCm39) M249L probably benign Het
Meltf T C 16: 31,702,612 (GRCm39) V113A probably damaging Het
Muc16 T A 9: 18,571,538 (GRCm39) H327L unknown Het
Myh1 A G 11: 67,106,748 (GRCm39) I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Naga C A 15: 82,214,348 (GRCm39) V388L probably benign Het
Nfkb1 A C 3: 135,291,162 (GRCm39) M957R possibly damaging Het
Nol12 C A 15: 78,824,793 (GRCm39) S157* probably null Het
Or13c25 A G 4: 52,911,368 (GRCm39) V142A possibly damaging Het
Or5g23 A G 2: 85,438,751 (GRCm39) F168L possibly damaging Het
Or8u3-ps A T 2: 85,952,840 (GRCm39) D191V possibly damaging Het
Pcdhga5 T C 18: 37,828,098 (GRCm39) V182A probably benign Het
Pik3r4 A G 9: 105,547,081 (GRCm39) E953G probably damaging Het
Piwil2 C T 14: 70,631,506 (GRCm39) R646Q probably damaging Het
Plxnc1 T C 10: 94,779,971 (GRCm39) H157R probably damaging Het
Prrg4 A T 2: 104,669,723 (GRCm39) F131L probably benign Het
Prss3b C A 6: 41,010,127 (GRCm39) R69L probably benign Het
Rab28 A G 5: 41,865,313 (GRCm39) S4P probably damaging Het
Ranbp2 C A 10: 58,291,260 (GRCm39) Q209K probably benign Het
Schip1 G A 3: 67,972,317 (GRCm39) D15N probably benign Het
Serpina3f T G 12: 104,184,477 (GRCm39) M207R probably benign Het
Sgsm1 A T 5: 113,422,193 (GRCm39) M487K possibly damaging Het
Sh3tc2 A T 18: 62,122,651 (GRCm39) I471F probably benign Het
Slamf1 G A 1: 171,602,467 (GRCm39) V65I possibly damaging Het
Slit3 T C 11: 35,574,871 (GRCm39) C1062R probably damaging Het
Snapc4 T G 2: 26,263,446 (GRCm39) K344N probably damaging Het
Sorl1 A G 9: 41,895,822 (GRCm39) Y1778H probably damaging Het
Spon2 G A 5: 33,373,019 (GRCm39) R228C probably damaging Het
Sv2c A G 13: 96,113,203 (GRCm39) I582T possibly damaging Het
Tamm41 C T 6: 114,993,139 (GRCm39) V205M probably damaging Het
Trpm2 T C 10: 77,761,623 (GRCm39) D1009G probably benign Het
Trpm6 T C 19: 18,831,613 (GRCm39) S1493P probably damaging Het
Ttc34 G A 4: 154,923,731 (GRCm39) V147I possibly damaging Het
Tut7 A G 13: 59,947,496 (GRCm39) F942L probably benign Het
Uba2 C T 7: 33,850,275 (GRCm39) A393T probably damaging Het
Ubn2 T A 6: 38,440,873 (GRCm39) N416K probably benign Het
Uevld T C 7: 46,593,553 (GRCm39) N233S probably benign Het
Upp2 G A 2: 58,664,160 (GRCm39) M142I possibly damaging Het
Vps52 T A 17: 34,181,108 (GRCm39) V450D probably benign Het
Wdr31 A T 4: 62,378,873 (GRCm39) F118Y probably damaging Het
Zfp110 T A 7: 12,582,922 (GRCm39) D523E possibly damaging Het
Zfp367 A T 13: 64,293,457 (GRCm39) V143D probably damaging Het
Zfp950 T C 19: 61,108,379 (GRCm39) I235V probably benign Het
Other mutations in Grm6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00432:Grm6 APN 11 50,754,124 (GRCm39) splice site probably benign
IGL01305:Grm6 APN 11 50,750,346 (GRCm39) missense probably benign 0.27
IGL02121:Grm6 APN 11 50,750,483 (GRCm39) missense probably damaging 1.00
IGL02413:Grm6 APN 11 50,750,766 (GRCm39) missense probably damaging 0.99
ANU22:Grm6 UTSW 11 50,750,346 (GRCm39) missense probably benign 0.27
R0089:Grm6 UTSW 11 50,750,792 (GRCm39) missense probably damaging 1.00
R0135:Grm6 UTSW 11 50,744,050 (GRCm39) missense probably damaging 0.99
R0147:Grm6 UTSW 11 50,750,144 (GRCm39) missense possibly damaging 0.89
R1498:Grm6 UTSW 11 50,748,083 (GRCm39) missense probably damaging 1.00
R1577:Grm6 UTSW 11 50,753,972 (GRCm39) missense probably damaging 1.00
R1666:Grm6 UTSW 11 50,750,711 (GRCm39) missense probably damaging 1.00
R2923:Grm6 UTSW 11 50,755,348 (GRCm39) missense probably damaging 1.00
R4060:Grm6 UTSW 11 50,744,051 (GRCm39) missense probably damaging 1.00
R4486:Grm6 UTSW 11 50,750,816 (GRCm39) missense probably damaging 0.99
R4488:Grm6 UTSW 11 50,750,816 (GRCm39) missense probably damaging 0.99
R4489:Grm6 UTSW 11 50,750,816 (GRCm39) missense probably damaging 0.99
R4646:Grm6 UTSW 11 50,748,033 (GRCm39) missense probably benign 0.03
R4701:Grm6 UTSW 11 50,753,837 (GRCm39) missense probably damaging 1.00
R4785:Grm6 UTSW 11 50,748,104 (GRCm39) missense probably benign 0.00
R4860:Grm6 UTSW 11 50,755,439 (GRCm39) missense probably benign 0.31
R5603:Grm6 UTSW 11 50,747,786 (GRCm39) missense probably damaging 1.00
R6104:Grm6 UTSW 11 50,750,144 (GRCm39) missense possibly damaging 0.89
R6746:Grm6 UTSW 11 50,747,790 (GRCm39) missense probably damaging 1.00
R6791:Grm6 UTSW 11 50,750,601 (GRCm39) missense possibly damaging 0.74
R6802:Grm6 UTSW 11 50,744,216 (GRCm39) missense probably benign 0.24
R6856:Grm6 UTSW 11 50,750,652 (GRCm39) missense probably damaging 1.00
R7102:Grm6 UTSW 11 50,753,804 (GRCm39) missense possibly damaging 0.87
R7221:Grm6 UTSW 11 50,753,870 (GRCm39) missense probably damaging 0.97
R7783:Grm6 UTSW 11 50,753,909 (GRCm39) missense probably damaging 1.00
R7876:Grm6 UTSW 11 50,750,457 (GRCm39) missense probably damaging 1.00
R8006:Grm6 UTSW 11 50,755,484 (GRCm39) makesense probably null
R8985:Grm6 UTSW 11 50,746,537 (GRCm39) missense possibly damaging 0.94
R9666:Grm6 UTSW 11 50,750,877 (GRCm39) missense probably damaging 1.00
X0025:Grm6 UTSW 11 50,753,922 (GRCm39) missense probably damaging 1.00
Z1176:Grm6 UTSW 11 50,750,364 (GRCm39) missense probably benign 0.43
Z1177:Grm6 UTSW 11 50,750,694 (GRCm39) missense probably damaging 1.00
Z1177:Grm6 UTSW 11 50,742,327 (GRCm39) missense probably benign 0.00
Z1177:Grm6 UTSW 11 50,742,089 (GRCm39) missense probably benign 0.40
Predicted Primers PCR Primer
(F):5'- GGTAACTTCCTTTCCCGCAG -3'
(R):5'- ATCTGCCTCTGTGGACAAAAC -3'

Sequencing Primer
(F):5'- ATGCTCTACGCGCTGGAC -3'
(R):5'- CTGTGGACAAAACCTTTTTAATCTGG -3'
Posted On 2019-11-12