Incidental Mutation 'R0242:Otog'
ID 59558
Institutional Source Beutler Lab
Gene Symbol Otog
Ensembl Gene ENSMUSG00000009487
Gene Name otogelin
Synonyms Otgn
MMRRC Submission 038480-MU
Accession Numbers
Essential gene? Probably essential (E-score: 0.770) question?
Stock # R0242 (G1)
Quality Score 155
Status Validated
Chromosome 7
Chromosomal Location 45890411-45960858 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 45916805 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Cysteine to Phenylalanine at position 914 (C914F)
Ref Sequence ENSEMBL: ENSMUSP00000130949 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000164538]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000164538
AA Change: C914F

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000130949
Gene: ENSMUSG00000009487
AA Change: C914F

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
VWD 128 288 7.98e-45 SMART
C8 330 404 1.05e-13 SMART
VWC 463 505 1.24e0 SMART
VWD 490 655 4.94e-50 SMART
C8 693 758 1.23e-5 SMART
Pfam:TIL 767 831 3.4e-13 PFAM
VWC 935 983 1.83e0 SMART
VWD 962 1118 6.05e-45 SMART
C8 1153 1227 1.02e-34 SMART
Pfam:AbfB 1270 1384 7.5e-10 PFAM
low complexity region 1488 1513 N/A INTRINSIC
low complexity region 1524 1536 N/A INTRINSIC
low complexity region 1560 1578 N/A INTRINSIC
low complexity region 1637 1644 N/A INTRINSIC
low complexity region 1677 1696 N/A INTRINSIC
low complexity region 1731 1748 N/A INTRINSIC
VWD 2087 2251 2.37e-29 SMART
C8 2287 2356 4.93e-19 SMART
low complexity region 2443 2449 N/A INTRINSIC
CT 2828 2911 3.46e-28 SMART
Meta Mutation Damage Score 0.9221 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a component of the acellular membranes of the inner ear. Disruption of the orthologous mouse gene shows that it plays a role in auditory and vestibular functions. It is involved in fibrillar network organization, the anchoring of otoconial membranes and cupulae to the neuroepithelia, and likely in sound stimulation resistance. Mutations in this gene cause autosomal recessive nonsyndromic deafness, type 18B. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Homozygotes for a number of different spontaneous and targeted mutations exhibit vestibular dysfunction, including circling, head tilt, impaired balance, coordination, and placing response. Mutants have impaired hearing, decreased brain stem auditory evoked potential, and ear abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,601,676 (GRCm39) D230G probably benign Het
Abhd13 A G 8: 10,037,561 (GRCm39) I53V probably benign Het
Adgrl2 A C 3: 148,544,821 (GRCm39) probably null Het
Aldh16a1 G A 7: 44,794,088 (GRCm39) A596V probably damaging Het
Aldh3b2 T A 19: 4,029,414 (GRCm39) Y262* probably null Het
Ambn A G 5: 88,615,831 (GRCm39) Q420R possibly damaging Het
Ankib1 A C 5: 3,750,344 (GRCm39) probably benign Het
Arhgap9 C A 10: 127,165,407 (GRCm39) H430Q probably benign Het
Arhgef25 C T 10: 127,019,933 (GRCm39) G435E probably damaging Het
Armc12 A T 17: 28,751,366 (GRCm39) D120V possibly damaging Het
Asxl3 G A 18: 22,649,738 (GRCm39) E576K possibly damaging Het
Bcdin3d T C 15: 99,368,776 (GRCm39) E141G probably benign Het
Bmpr1b G A 3: 141,546,437 (GRCm39) T483M probably damaging Het
Caprin2 C T 6: 148,744,452 (GRCm39) S991N probably damaging Het
Cd96 T C 16: 45,892,129 (GRCm39) I286M possibly damaging Het
Cdcp1 G T 9: 123,009,237 (GRCm39) F480L probably benign Het
Celf5 T C 10: 81,300,243 (GRCm39) T258A probably benign Het
Cgnl1 A G 9: 71,628,939 (GRCm39) V577A probably damaging Het
Clca3b A G 3: 144,547,226 (GRCm39) S304P probably benign Het
Cmya5 A T 13: 93,232,108 (GRCm39) H993Q probably benign Het
Cnbp A T 6: 87,822,746 (GRCm39) C6S probably damaging Het
Col14a1 C T 15: 55,360,907 (GRCm39) R1605W probably damaging Het
Cops7a T C 6: 124,941,817 (GRCm39) N11S probably benign Het
Coro7 T C 16: 4,448,042 (GRCm39) probably benign Het
Cpvl T C 6: 53,909,485 (GRCm39) H217R possibly damaging Het
Cuedc1 T C 11: 88,075,447 (GRCm39) probably benign Het
Cyp2c66 A G 19: 39,130,369 (GRCm39) Y68C probably damaging Het
Dicer1 G A 12: 104,668,710 (GRCm39) T1324M probably benign Het
Dlgap2 A G 8: 14,777,562 (GRCm39) D268G probably benign Het
Dnm1 T A 2: 32,207,001 (GRCm39) M535L possibly damaging Het
Dock7 A T 4: 98,850,517 (GRCm39) F1575Y probably benign Het
Dpp10 T A 1: 123,326,275 (GRCm39) H403L possibly damaging Het
Dync1h1 A G 12: 110,616,285 (GRCm39) D3112G possibly damaging Het
Eno3 A G 11: 70,548,761 (GRCm39) E21G probably null Het
Fam120b T A 17: 15,643,186 (GRCm39) V655D probably damaging Het
Fkbp5 A T 17: 28,647,426 (GRCm39) D136E probably benign Het
Gdap1l1 T A 2: 163,289,573 (GRCm39) Y179* probably null Het
Gfer A G 17: 24,913,277 (GRCm39) W192R probably damaging Het
Gm4782 A G 6: 50,586,838 (GRCm39) T408A probably benign Het
Golgb1 C T 16: 36,695,992 (GRCm39) Q164* probably null Het
Gpnmb A G 6: 49,024,276 (GRCm39) N197S probably damaging Het
Gtf2f1 G A 17: 57,310,802 (GRCm39) T414M probably benign Het
Hc A G 2: 34,926,166 (GRCm39) probably benign Het
Hcfc1 A T X: 72,992,035 (GRCm39) probably benign Het
Helz2 C T 2: 180,872,223 (GRCm39) R2539Q probably damaging Het
Hsd17b12 T A 2: 93,988,160 (GRCm39) I19F probably benign Het
Incenp T C 19: 9,871,114 (GRCm39) T172A unknown Het
Jmy A G 13: 93,578,126 (GRCm39) Y681H probably benign Het
Kbtbd11 A G 8: 15,077,508 (GRCm39) T36A probably benign Het
Kcnh4 T C 11: 100,646,525 (GRCm39) D267G probably damaging Het
Krt34 C T 11: 99,932,157 (GRCm39) E56K probably damaging Het
Krt40 T A 11: 99,429,568 (GRCm39) E335D probably damaging Het
Krt86 T A 15: 101,374,454 (GRCm39) Y282* probably null Het
Lgi3 C T 14: 70,772,255 (GRCm39) R267* probably null Het
Lnpk A G 2: 74,367,633 (GRCm39) probably benign Het
Lrp1b T A 2: 40,888,195 (GRCm39) H2355L probably benign Het
Lrrc8e G A 8: 4,285,401 (GRCm39) R542H probably benign Het
Mia2 T C 12: 59,155,642 (GRCm39) Y452H probably damaging Het
Mmachc C T 4: 116,561,738 (GRCm39) R132Q probably damaging Het
Mtbp T A 15: 55,440,882 (GRCm39) N356K possibly damaging Het
Myo5b A G 18: 74,794,787 (GRCm39) H552R possibly damaging Het
Niban1 A G 1: 151,593,967 (GRCm39) D884G probably benign Het
Noxred1 A G 12: 87,273,753 (GRCm39) V96A probably benign Het
Nr1d2 T A 14: 18,211,933 (GRCm38) D390V possibly damaging Het
Oas1e A T 5: 120,929,839 (GRCm39) probably benign Het
Odad2 A T 18: 7,211,516 (GRCm39) V786D probably damaging Het
Or1r1 T C 11: 73,874,538 (GRCm39) S299G probably benign Het
Or6c1b T A 10: 129,273,217 (GRCm39) Y179N probably damaging Het
Pank2 G T 2: 131,122,117 (GRCm39) C214F probably damaging Het
Pcdhb1 T A 18: 37,399,788 (GRCm39) S580T probably benign Het
Pdia3 T C 2: 121,244,592 (GRCm39) S2P probably damaging Het
Peli1 G T 11: 21,092,602 (GRCm39) R83L probably damaging Het
Pla2g3 T A 11: 3,441,935 (GRCm39) C366* probably null Het
Pon3 T A 6: 5,240,860 (GRCm39) D107V probably benign Het
Ppip5k2 A G 1: 97,668,816 (GRCm39) C532R probably damaging Het
Prph A T 15: 98,953,608 (GRCm39) D174V probably damaging Het
Psd3 A G 8: 68,210,738 (GRCm39) M270T probably damaging Het
Pum3 A G 19: 27,400,155 (GRCm39) probably benign Het
Pus1 A T 5: 110,927,664 (GRCm39) H30Q probably benign Het
Pwwp3a T C 10: 80,070,092 (GRCm39) S354P probably benign Het
Rab7 A T 6: 87,982,114 (GRCm39) V87E probably damaging Het
Rbm5 A T 9: 107,628,907 (GRCm39) probably benign Het
Reln A G 5: 22,147,595 (GRCm39) probably null Het
S1pr3 A G 13: 51,572,938 (GRCm39) T40A probably benign Het
Sdk1 T A 5: 142,129,677 (GRCm39) probably benign Het
Senp7 T A 16: 55,999,884 (GRCm39) I853N probably damaging Het
Serpinb6c T A 13: 34,083,230 (GRCm39) probably benign Het
Shroom1 T G 11: 53,356,312 (GRCm39) probably null Het
Slc24a3 T C 2: 145,448,584 (GRCm39) I376T probably benign Het
Slc46a1 T C 11: 78,359,493 (GRCm39) I375T possibly damaging Het
Slc4a9 T C 18: 36,666,733 (GRCm39) F527S probably damaging Het
Slc4a9 T A 18: 36,674,286 (GRCm39) I924N probably damaging Het
Slx4 T A 16: 3,804,816 (GRCm39) E666V probably damaging Het
Snrnp27 G A 6: 86,652,575 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,216,659 (GRCm39) G640E probably damaging Het
Spmap2l G T 5: 77,164,152 (GRCm39) E52* probably null Het
Sptan1 A T 2: 29,908,413 (GRCm39) M1725L probably benign Het
Sync G A 4: 129,187,514 (GRCm39) R182K probably damaging Het
Syne2 G A 12: 76,144,808 (GRCm39) G1586S probably damaging Het
Sytl1 G T 4: 132,980,768 (GRCm39) T522K probably damaging Het
Tex2 T A 11: 106,410,781 (GRCm39) K414* probably null Het
Tex55 C T 16: 38,644,929 (GRCm39) probably benign Het
Thsd7a G A 6: 12,503,915 (GRCm39) T413I probably benign Het
Tm9sf1 C T 14: 55,875,392 (GRCm39) A451T possibly damaging Het
Ttn A T 2: 76,656,496 (GRCm39) probably benign Het
Uba2 T C 7: 33,854,054 (GRCm39) I140V possibly damaging Het
Ushbp1 C A 8: 71,842,762 (GRCm39) G361* probably null Het
Wbp2nl C T 15: 82,197,988 (GRCm39) A175V probably benign Het
Zc3h12d A G 10: 7,738,330 (GRCm39) E212G probably damaging Het
Zc3h7b T C 15: 81,653,031 (GRCm39) probably benign Het
Other mutations in Otog
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00516:Otog APN 7 45,900,706 (GRCm39) missense probably damaging 1.00
IGL00725:Otog APN 7 45,923,516 (GRCm39) missense probably damaging 1.00
IGL00757:Otog APN 7 45,939,552 (GRCm39) missense probably damaging 1.00
IGL00822:Otog APN 7 45,945,304 (GRCm39) missense probably benign 0.24
IGL01354:Otog APN 7 45,939,150 (GRCm39) missense probably damaging 1.00
IGL01567:Otog APN 7 45,926,039 (GRCm39) splice site probably benign
IGL02034:Otog APN 7 45,945,417 (GRCm39) nonsense probably null
IGL02090:Otog APN 7 45,949,571 (GRCm39) missense probably damaging 1.00
IGL02132:Otog APN 7 45,954,903 (GRCm39) missense probably damaging 0.99
IGL02148:Otog APN 7 45,950,011 (GRCm39) missense probably damaging 1.00
IGL02173:Otog APN 7 45,926,165 (GRCm39) splice site probably benign
IGL02199:Otog APN 7 45,926,775 (GRCm39) missense possibly damaging 0.90
IGL02216:Otog APN 7 45,950,892 (GRCm39) missense probably damaging 1.00
IGL02322:Otog APN 7 45,950,881 (GRCm39) missense probably benign 0.01
IGL02330:Otog APN 7 45,937,493 (GRCm39) missense possibly damaging 0.84
IGL02529:Otog APN 7 45,909,381 (GRCm39) missense probably damaging 0.99
IGL02898:Otog APN 7 45,959,562 (GRCm39) missense probably damaging 1.00
IGL02970:Otog APN 7 45,945,291 (GRCm39) missense probably benign 0.11
IGL03085:Otog APN 7 45,955,346 (GRCm39) critical splice donor site probably null
IGL03108:Otog APN 7 45,900,762 (GRCm39) missense probably damaging 1.00
IGL03275:Otog APN 7 45,955,654 (GRCm39) missense probably damaging 1.00
R0282_Otog_616 UTSW 7 45,926,917 (GRCm39) missense possibly damaging 0.93
R0636_otog_678 UTSW 7 45,913,652 (GRCm39) critical splice donor site probably null
R1029_otog_141 UTSW 7 45,924,019 (GRCm39) missense probably damaging 1.00
BB010:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
BB020:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
I1329:Otog UTSW 7 45,895,927 (GRCm39) missense probably benign 0.02
IGL02984:Otog UTSW 7 45,954,932 (GRCm39) missense probably damaging 0.98
PIT4472001:Otog UTSW 7 45,945,273 (GRCm39) missense probably damaging 1.00
R0032:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0032:Otog UTSW 7 45,937,637 (GRCm39) nonsense probably null
R0105:Otog UTSW 7 45,937,790 (GRCm39) missense possibly damaging 0.79
R0164:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0164:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0165:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0166:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0167:Otog UTSW 7 45,953,655 (GRCm39) missense probably damaging 0.97
R0240:Otog UTSW 7 45,913,456 (GRCm39) splice site probably null
R0240:Otog UTSW 7 45,913,456 (GRCm39) splice site probably null
R0242:Otog UTSW 7 45,916,805 (GRCm39) missense probably damaging 0.98
R0282:Otog UTSW 7 45,926,917 (GRCm39) missense possibly damaging 0.93
R0392:Otog UTSW 7 45,899,499 (GRCm39) missense probably benign 0.00
R0436:Otog UTSW 7 45,915,360 (GRCm39) splice site probably benign
R0441:Otog UTSW 7 45,955,301 (GRCm39) missense probably damaging 1.00
R0499:Otog UTSW 7 45,923,256 (GRCm39) missense probably damaging 1.00
R0530:Otog UTSW 7 45,947,668 (GRCm39) missense probably damaging 0.98
R0541:Otog UTSW 7 45,918,673 (GRCm39) splice site probably benign
R0600:Otog UTSW 7 45,900,819 (GRCm39) splice site probably benign
R0626:Otog UTSW 7 45,920,797 (GRCm39) missense possibly damaging 0.95
R0636:Otog UTSW 7 45,913,652 (GRCm39) critical splice donor site probably null
R0764:Otog UTSW 7 45,949,918 (GRCm39) missense probably benign 0.00
R0833:Otog UTSW 7 45,918,786 (GRCm39) missense possibly damaging 0.94
R0836:Otog UTSW 7 45,918,786 (GRCm39) missense possibly damaging 0.94
R0844:Otog UTSW 7 45,937,252 (GRCm39) missense possibly damaging 0.53
R1029:Otog UTSW 7 45,924,019 (GRCm39) missense probably damaging 1.00
R1116:Otog UTSW 7 45,950,025 (GRCm39) splice site probably benign
R1134:Otog UTSW 7 45,947,938 (GRCm39) missense probably damaging 1.00
R1183:Otog UTSW 7 45,939,179 (GRCm39) missense probably benign 0.41
R1204:Otog UTSW 7 45,909,335 (GRCm39) missense probably benign 0.16
R1301:Otog UTSW 7 45,939,113 (GRCm39) missense probably damaging 1.00
R1344:Otog UTSW 7 45,924,039 (GRCm39) missense probably damaging 1.00
R1384:Otog UTSW 7 45,923,119 (GRCm39) splice site probably benign
R1418:Otog UTSW 7 45,924,039 (GRCm39) missense probably damaging 1.00
R1432:Otog UTSW 7 45,950,007 (GRCm39) missense probably damaging 1.00
R1479:Otog UTSW 7 45,945,402 (GRCm39) missense possibly damaging 0.75
R1521:Otog UTSW 7 45,908,688 (GRCm39) missense possibly damaging 0.71
R1589:Otog UTSW 7 45,933,332 (GRCm39) missense probably benign 0.18
R1671:Otog UTSW 7 45,911,210 (GRCm39) missense probably damaging 1.00
R1773:Otog UTSW 7 45,937,583 (GRCm39) missense probably benign 0.28
R1806:Otog UTSW 7 45,940,361 (GRCm39) critical splice acceptor site probably null
R1843:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R1873:Otog UTSW 7 45,918,767 (GRCm39) missense probably damaging 1.00
R1923:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R1927:Otog UTSW 7 45,895,707 (GRCm39) missense probably damaging 1.00
R2008:Otog UTSW 7 45,913,498 (GRCm39) missense probably benign 0.43
R2048:Otog UTSW 7 45,937,063 (GRCm39) missense probably damaging 1.00
R2131:Otog UTSW 7 45,899,524 (GRCm39) missense probably damaging 1.00
R2153:Otog UTSW 7 45,952,328 (GRCm39) missense probably damaging 1.00
R2240:Otog UTSW 7 45,890,453 (GRCm39) start codon destroyed probably null
R2278:Otog UTSW 7 45,949,468 (GRCm39) missense probably damaging 1.00
R2407:Otog UTSW 7 45,890,964 (GRCm39) missense probably benign 0.10
R2424:Otog UTSW 7 45,947,593 (GRCm39) nonsense probably null
R2513:Otog UTSW 7 45,955,014 (GRCm39) critical splice donor site probably null
R2863:Otog UTSW 7 45,918,730 (GRCm39) missense probably damaging 1.00
R3148:Otog UTSW 7 45,939,593 (GRCm39) missense probably damaging 1.00
R3732:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3732:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3733:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3734:Otog UTSW 7 45,937,792 (GRCm39) missense probably benign 0.03
R3855:Otog UTSW 7 45,923,184 (GRCm39) missense possibly damaging 0.65
R3880:Otog UTSW 7 45,937,445 (GRCm39) missense possibly damaging 0.93
R4081:Otog UTSW 7 45,937,723 (GRCm39) missense possibly damaging 0.92
R4349:Otog UTSW 7 45,923,613 (GRCm39) missense probably damaging 0.99
R4382:Otog UTSW 7 45,939,122 (GRCm39) missense probably damaging 1.00
R4392:Otog UTSW 7 45,934,548 (GRCm39) missense probably damaging 0.98
R4520:Otog UTSW 7 45,890,477 (GRCm39) unclassified probably benign
R4569:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R4580:Otog UTSW 7 45,937,225 (GRCm39) missense possibly damaging 0.78
R4672:Otog UTSW 7 45,939,210 (GRCm39) missense probably damaging 0.98
R4764:Otog UTSW 7 45,937,943 (GRCm39) missense probably benign 0.29
R4910:Otog UTSW 7 45,947,958 (GRCm39) missense probably damaging 1.00
R4910:Otog UTSW 7 45,913,486 (GRCm39) missense probably damaging 1.00
R4913:Otog UTSW 7 45,913,526 (GRCm39) missense probably benign 0.31
R4975:Otog UTSW 7 45,937,415 (GRCm39) missense probably benign 0.00
R4996:Otog UTSW 7 45,954,934 (GRCm39) nonsense probably null
R4996:Otog UTSW 7 45,948,030 (GRCm39) missense possibly damaging 0.51
R5116:Otog UTSW 7 45,923,191 (GRCm39) missense probably benign 0.34
R5138:Otog UTSW 7 45,899,430 (GRCm39) missense possibly damaging 0.61
R5169:Otog UTSW 7 45,947,572 (GRCm39) missense probably benign 0.06
R5239:Otog UTSW 7 45,936,859 (GRCm39) missense probably benign 0.15
R5277:Otog UTSW 7 45,896,045 (GRCm39) missense possibly damaging 0.89
R5287:Otog UTSW 7 45,918,753 (GRCm39) missense probably damaging 0.98
R5299:Otog UTSW 7 45,938,275 (GRCm39) missense probably benign 0.16
R5378:Otog UTSW 7 45,904,428 (GRCm39) missense probably damaging 1.00
R5382:Otog UTSW 7 45,898,428 (GRCm39) missense probably damaging 1.00
R5487:Otog UTSW 7 45,938,192 (GRCm39) missense probably benign 0.27
R5507:Otog UTSW 7 45,911,123 (GRCm39) missense probably damaging 1.00
R5517:Otog UTSW 7 45,923,995 (GRCm39) missense probably damaging 1.00
R5643:Otog UTSW 7 45,936,871 (GRCm39) missense probably damaging 1.00
R5757:Otog UTSW 7 45,890,545 (GRCm39) critical splice donor site probably null
R5910:Otog UTSW 7 45,948,022 (GRCm39) missense possibly damaging 0.94
R6019:Otog UTSW 7 45,938,374 (GRCm39) missense probably benign 0.00
R6150:Otog UTSW 7 45,913,483 (GRCm39) missense possibly damaging 0.82
R6225:Otog UTSW 7 45,898,458 (GRCm39) missense possibly damaging 0.67
R6271:Otog UTSW 7 45,901,464 (GRCm39) missense probably damaging 1.00
R6317:Otog UTSW 7 45,950,639 (GRCm39) missense probably damaging 1.00
R6454:Otog UTSW 7 45,955,241 (GRCm39) missense probably damaging 1.00
R6640:Otog UTSW 7 45,911,167 (GRCm39) missense possibly damaging 0.92
R6753:Otog UTSW 7 45,898,495 (GRCm39) missense probably benign 0.06
R6788:Otog UTSW 7 45,947,741 (GRCm39) missense probably damaging 1.00
R6859:Otog UTSW 7 45,923,205 (GRCm39) missense probably damaging 0.96
R7033:Otog UTSW 7 45,916,822 (GRCm39) critical splice donor site probably null
R7071:Otog UTSW 7 45,916,747 (GRCm39) missense probably damaging 1.00
R7084:Otog UTSW 7 45,947,990 (GRCm39) nonsense probably null
R7116:Otog UTSW 7 45,947,689 (GRCm39) missense probably damaging 0.99
R7202:Otog UTSW 7 45,937,474 (GRCm39) missense probably damaging 0.97
R7365:Otog UTSW 7 45,947,732 (GRCm39) missense probably damaging 1.00
R7468:Otog UTSW 7 45,913,543 (GRCm39) missense probably benign
R7475:Otog UTSW 7 45,916,700 (GRCm39) missense probably damaging 0.99
R7502:Otog UTSW 7 45,948,039 (GRCm39) missense probably damaging 1.00
R7558:Otog UTSW 7 45,952,584 (GRCm39) missense probably damaging 0.99
R7577:Otog UTSW 7 45,937,279 (GRCm39) missense possibly damaging 0.62
R7651:Otog UTSW 7 45,891,185 (GRCm39) missense probably benign 0.00
R7689:Otog UTSW 7 45,901,480 (GRCm39) missense probably damaging 1.00
R7806:Otog UTSW 7 45,935,200 (GRCm39) missense probably benign
R7933:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R8021:Otog UTSW 7 45,916,766 (GRCm39) missense probably damaging 0.98
R8082:Otog UTSW 7 45,939,143 (GRCm39) missense probably damaging 1.00
R8531:Otog UTSW 7 45,901,473 (GRCm39) missense probably damaging 0.99
R8772:Otog UTSW 7 45,934,352 (GRCm39) missense probably damaging 1.00
R8816:Otog UTSW 7 45,950,905 (GRCm39) missense possibly damaging 0.92
R8842:Otog UTSW 7 45,895,948 (GRCm39) missense probably damaging 1.00
R8987:Otog UTSW 7 45,936,878 (GRCm39) missense probably benign 0.43
R8988:Otog UTSW 7 45,959,571 (GRCm39) missense probably damaging 1.00
R9010:Otog UTSW 7 45,949,894 (GRCm39) missense probably benign 0.00
R9025:Otog UTSW 7 45,937,520 (GRCm39) missense probably benign 0.13
R9131:Otog UTSW 7 45,952,597 (GRCm39) nonsense probably null
R9179:Otog UTSW 7 45,937,885 (GRCm39) missense possibly damaging 0.65
R9334:Otog UTSW 7 45,909,353 (GRCm39) missense possibly damaging 0.95
R9365:Otog UTSW 7 45,920,688 (GRCm39) missense probably damaging 1.00
R9408:Otog UTSW 7 45,916,721 (GRCm39) missense possibly damaging 0.79
R9418:Otog UTSW 7 45,938,024 (GRCm39) missense probably benign 0.41
R9465:Otog UTSW 7 45,955,299 (GRCm39) missense possibly damaging 0.80
R9496:Otog UTSW 7 45,890,505 (GRCm39) missense unknown
R9632:Otog UTSW 7 45,915,143 (GRCm39) missense probably benign 0.27
R9656:Otog UTSW 7 45,959,567 (GRCm39) missense probably damaging 1.00
RF024:Otog UTSW 7 45,937,093 (GRCm39) missense probably damaging 1.00
X0062:Otog UTSW 7 45,909,345 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,939,164 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,923,962 (GRCm39) missense probably damaging 1.00
Z1177:Otog UTSW 7 45,912,276 (GRCm39) missense possibly damaging 0.80
Z1177:Otog UTSW 7 45,959,409 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AAGACTTATCTGCTTTGTCCCCGTG -3'
(R):5'- TCCCTTGGGCATTTGGGGTACATC -3'

Sequencing Primer
(F):5'- TTTGTCCCCGTGATGCG -3'
(R):5'- ctcgcaggacgcagaac -3'
Posted On 2013-07-11