Incidental Mutation 'R7727:Dgkh'
ID 595583
Institutional Source Beutler Lab
Gene Symbol Dgkh
Ensembl Gene ENSMUSG00000034731
Gene Name diacylglycerol kinase, eta
Synonyms 5930402B05Rik
MMRRC Submission 045783-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7727 (G1)
Quality Score 225.009
Status Validated
Chromosome 14
Chromosomal Location 78796789-78970169 bp(-) (GRCm39)
Type of Mutation critical splice donor site (2 bp from exon)
DNA Base Change (assembly) A to G at 78832585 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000074290 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000074729] [ENSMUST00000226342] [ENSMUST00000227537] [ENSMUST00000227767] [ENSMUST00000228362]
AlphaFold no structure available at present
Predicted Effect probably null
Transcript: ENSMUST00000074729
SMART Domains Protein: ENSMUSP00000074290
Gene: ENSMUSG00000034731

DomainStartEndE-ValueType
low complexity region 12 32 N/A INTRINSIC
PH 63 157 1.91e-19 SMART
C1 173 222 1.35e-16 SMART
C1 245 295 1.66e-7 SMART
DAGKc 329 454 3.11e-62 SMART
low complexity region 654 667 N/A INTRINSIC
low complexity region 715 730 N/A INTRINSIC
DAGKa 762 919 1.74e-92 SMART
low complexity region 1124 1134 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000226342
Predicted Effect probably benign
Transcript: ENSMUST00000227537
Predicted Effect probably null
Transcript: ENSMUST00000227767
Predicted Effect probably null
Transcript: ENSMUST00000228362
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the diacylglycerol kinase (DGK) enzyme family. Members of this family are involved in regulating intracellular concentrations of diacylglycerol and phosphatidic acid. Variation in this gene has been associated with bipolar disorder. Alternatively spliced transcript variants have been identified. [provided by RefSeq, Jul 2014]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A T 16: 85,696,854 (GRCm39) L101Q probably damaging Het
Arhgap18 A T 10: 26,746,007 (GRCm39) I293F possibly damaging Het
Atp8b1 T A 18: 64,678,346 (GRCm39) Q850L probably damaging Het
B4galnt3 A T 6: 120,202,148 (GRCm39) F118Y probably benign Het
Bcl6 A G 16: 23,790,163 (GRCm39) probably null Het
Cc2d2b T A 19: 40,744,974 (GRCm39) L31Q probably benign Het
Cd5l G T 3: 87,275,162 (GRCm39) E234* probably null Het
Cemip2 C T 19: 21,807,321 (GRCm39) L917F probably benign Het
Cfap65 T C 1: 74,965,784 (GRCm39) T409A probably benign Het
Chst5 A T 8: 112,617,557 (GRCm39) I21N probably benign Het
Cldn20 T C 17: 3,583,030 (GRCm39) Y68H probably benign Het
Col4a4 T C 1: 82,506,514 (GRCm39) M269V unknown Het
Dpp6 A G 5: 27,656,242 (GRCm39) T166A probably benign Het
Drosha A G 15: 12,881,731 (GRCm39) D754G probably damaging Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Fsd1 T G 17: 56,295,150 (GRCm39) D46E probably benign Het
Gabra1 T C 11: 42,024,418 (GRCm39) D419G probably damaging Het
Golga4 T A 9: 118,377,770 (GRCm39) D458E probably damaging Het
Grm6 C A 11: 50,742,369 (GRCm39) A134E probably benign Het
Ikzf1 T A 11: 11,698,339 (GRCm39) S63R probably damaging Het
Ilvbl G A 10: 78,412,500 (GRCm39) V74I probably benign Het
Kcng2 C T 18: 80,339,305 (GRCm39) V328M probably benign Het
Kpna7 T C 5: 144,941,855 (GRCm39) E145G probably benign Het
Krt81 A G 15: 101,357,448 (GRCm39) V428A probably damaging Het
Lalba T C 15: 98,380,549 (GRCm39) M2V probably benign Het
Lrpprc T C 17: 85,084,375 (GRCm39) S113G probably benign Het
Mboat1 A C 13: 30,410,289 (GRCm39) M249L probably benign Het
Meltf T C 16: 31,702,612 (GRCm39) V113A probably damaging Het
Muc16 T A 9: 18,571,538 (GRCm39) H327L unknown Het
Myh1 A G 11: 67,106,748 (GRCm39) I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Naga C A 15: 82,214,348 (GRCm39) V388L probably benign Het
Nfkb1 A C 3: 135,291,162 (GRCm39) M957R possibly damaging Het
Nol12 C A 15: 78,824,793 (GRCm39) S157* probably null Het
Or13c25 A G 4: 52,911,368 (GRCm39) V142A possibly damaging Het
Or5g23 A G 2: 85,438,751 (GRCm39) F168L possibly damaging Het
Or8u3-ps A T 2: 85,952,840 (GRCm39) D191V possibly damaging Het
Pcdhga5 T C 18: 37,828,098 (GRCm39) V182A probably benign Het
Pik3r4 A G 9: 105,547,081 (GRCm39) E953G probably damaging Het
Piwil2 C T 14: 70,631,506 (GRCm39) R646Q probably damaging Het
Plxnc1 T C 10: 94,779,971 (GRCm39) H157R probably damaging Het
Prrg4 A T 2: 104,669,723 (GRCm39) F131L probably benign Het
Prss3b C A 6: 41,010,127 (GRCm39) R69L probably benign Het
Rab28 A G 5: 41,865,313 (GRCm39) S4P probably damaging Het
Ranbp2 C A 10: 58,291,260 (GRCm39) Q209K probably benign Het
Schip1 G A 3: 67,972,317 (GRCm39) D15N probably benign Het
Serpina3f T G 12: 104,184,477 (GRCm39) M207R probably benign Het
Sgsm1 A T 5: 113,422,193 (GRCm39) M487K possibly damaging Het
Sh3tc2 A T 18: 62,122,651 (GRCm39) I471F probably benign Het
Slamf1 G A 1: 171,602,467 (GRCm39) V65I possibly damaging Het
Slit3 T C 11: 35,574,871 (GRCm39) C1062R probably damaging Het
Snapc4 T G 2: 26,263,446 (GRCm39) K344N probably damaging Het
Sorl1 A G 9: 41,895,822 (GRCm39) Y1778H probably damaging Het
Spon2 G A 5: 33,373,019 (GRCm39) R228C probably damaging Het
Sv2c A G 13: 96,113,203 (GRCm39) I582T possibly damaging Het
Tamm41 C T 6: 114,993,139 (GRCm39) V205M probably damaging Het
Trpm2 T C 10: 77,761,623 (GRCm39) D1009G probably benign Het
Trpm6 T C 19: 18,831,613 (GRCm39) S1493P probably damaging Het
Ttc34 G A 4: 154,923,731 (GRCm39) V147I possibly damaging Het
Tut7 A G 13: 59,947,496 (GRCm39) F942L probably benign Het
Uba2 C T 7: 33,850,275 (GRCm39) A393T probably damaging Het
Ubn2 T A 6: 38,440,873 (GRCm39) N416K probably benign Het
Uevld T C 7: 46,593,553 (GRCm39) N233S probably benign Het
Upp2 G A 2: 58,664,160 (GRCm39) M142I possibly damaging Het
Vps52 T A 17: 34,181,108 (GRCm39) V450D probably benign Het
Wdr31 A T 4: 62,378,873 (GRCm39) F118Y probably damaging Het
Zfp110 T A 7: 12,582,922 (GRCm39) D523E possibly damaging Het
Zfp367 A T 13: 64,293,457 (GRCm39) V143D probably damaging Het
Zfp950 T C 19: 61,108,379 (GRCm39) I235V probably benign Het
Other mutations in Dgkh
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00654:Dgkh APN 14 78,847,033 (GRCm39) missense possibly damaging 0.92
IGL00767:Dgkh APN 14 78,824,701 (GRCm39) splice site probably benign
IGL00787:Dgkh APN 14 78,855,954 (GRCm39) splice site probably benign
IGL01503:Dgkh APN 14 78,853,710 (GRCm39) missense possibly damaging 0.96
IGL02308:Dgkh APN 14 78,825,016 (GRCm39) missense probably benign 0.01
IGL02707:Dgkh APN 14 78,823,091 (GRCm39) missense possibly damaging 0.75
IGL02987:Dgkh APN 14 78,827,312 (GRCm39) critical splice donor site probably null
IGL03058:Dgkh APN 14 78,865,237 (GRCm39) missense probably benign 0.23
IGL03341:Dgkh APN 14 78,832,931 (GRCm39) splice site probably benign
PIT1430001:Dgkh UTSW 14 78,818,953 (GRCm39) missense probably damaging 1.00
PIT4445001:Dgkh UTSW 14 78,813,382 (GRCm39) missense possibly damaging 0.91
R0153:Dgkh UTSW 14 78,807,569 (GRCm39) nonsense probably null
R0730:Dgkh UTSW 14 78,821,919 (GRCm39) missense probably damaging 0.99
R1136:Dgkh UTSW 14 78,862,329 (GRCm39) missense probably damaging 1.00
R1162:Dgkh UTSW 14 78,861,891 (GRCm39) missense probably damaging 1.00
R1689:Dgkh UTSW 14 78,855,984 (GRCm39) missense possibly damaging 0.86
R1771:Dgkh UTSW 14 78,846,967 (GRCm39) missense probably damaging 1.00
R1861:Dgkh UTSW 14 78,816,232 (GRCm39) missense probably benign 0.04
R1916:Dgkh UTSW 14 78,832,663 (GRCm39) missense probably damaging 0.97
R1930:Dgkh UTSW 14 78,853,945 (GRCm39) missense probably damaging 1.00
R1931:Dgkh UTSW 14 78,853,945 (GRCm39) missense probably damaging 1.00
R1956:Dgkh UTSW 14 78,855,981 (GRCm39) missense probably damaging 1.00
R2007:Dgkh UTSW 14 78,840,489 (GRCm39) missense probably benign 0.09
R3747:Dgkh UTSW 14 78,821,885 (GRCm39) missense probably damaging 1.00
R4446:Dgkh UTSW 14 78,865,523 (GRCm39) missense probably damaging 1.00
R4475:Dgkh UTSW 14 78,827,318 (GRCm39) missense possibly damaging 0.80
R4965:Dgkh UTSW 14 78,861,861 (GRCm39) missense probably damaging 1.00
R4970:Dgkh UTSW 14 78,856,077 (GRCm39) missense probably damaging 1.00
R5071:Dgkh UTSW 14 78,841,972 (GRCm39) missense probably damaging 1.00
R5652:Dgkh UTSW 14 78,865,201 (GRCm39) missense probably damaging 1.00
R5726:Dgkh UTSW 14 78,862,342 (GRCm39) missense probably benign 0.16
R5773:Dgkh UTSW 14 78,832,895 (GRCm39) missense probably damaging 1.00
R5855:Dgkh UTSW 14 78,861,944 (GRCm39) critical splice acceptor site probably null
R6041:Dgkh UTSW 14 78,825,067 (GRCm39) missense probably damaging 1.00
R6192:Dgkh UTSW 14 78,865,504 (GRCm39) nonsense probably null
R6868:Dgkh UTSW 14 78,862,293 (GRCm39) missense probably damaging 0.99
R6981:Dgkh UTSW 14 78,865,182 (GRCm39) nonsense probably null
R7095:Dgkh UTSW 14 78,865,224 (GRCm39) missense probably benign 0.07
R7473:Dgkh UTSW 14 78,836,483 (GRCm39) missense probably benign 0.00
R7495:Dgkh UTSW 14 78,816,239 (GRCm39) missense probably benign
R7711:Dgkh UTSW 14 78,962,459 (GRCm39) missense probably benign
R7823:Dgkh UTSW 14 78,841,921 (GRCm39) missense probably benign
R7846:Dgkh UTSW 14 78,856,026 (GRCm39) missense probably damaging 0.99
R7967:Dgkh UTSW 14 78,857,256 (GRCm39) missense probably benign 0.10
R8085:Dgkh UTSW 14 78,824,558 (GRCm39) critical splice donor site probably null
R8285:Dgkh UTSW 14 78,865,566 (GRCm39) missense probably benign 0.18
R8669:Dgkh UTSW 14 78,962,459 (GRCm39) missense probably benign
R9069:Dgkh UTSW 14 78,853,957 (GRCm39) missense probably damaging 1.00
R9187:Dgkh UTSW 14 78,832,601 (GRCm39) missense probably damaging 0.97
R9225:Dgkh UTSW 14 78,962,507 (GRCm39) missense probably damaging 0.98
R9410:Dgkh UTSW 14 78,862,293 (GRCm39) missense probably damaging 0.99
R9615:Dgkh UTSW 14 78,813,370 (GRCm39) missense possibly damaging 0.85
R9761:Dgkh UTSW 14 78,889,163 (GRCm39) missense probably damaging 1.00
X0022:Dgkh UTSW 14 78,832,901 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTATTTGCATGGCTCCACCC -3'
(R):5'- CAACTACTTTGGGATTGGATTAGATGC -3'

Sequencing Primer
(F):5'- ATGGCTCCACCCTGGTG -3'
(R):5'- GGAGCACCCTGAAAAATGC -3'
Posted On 2019-11-12