Incidental Mutation 'R7727:Epb41l4a'
ID595596
Institutional Source Beutler Lab
Gene Symbol Epb41l4a
Ensembl Gene ENSMUSG00000024376
Gene Nameerythrocyte membrane protein band 4.1 like 4a
SynonymsNBL4, Epb4.1l4a
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7727 (G1)
Quality Score225.009
Status Validated
Chromosome18
Chromosomal Location33796327-34007206 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 33854273 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Asparagine at position 350 (K350N)
Ref Sequence ENSEMBL: ENSMUSP00000025234 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025234]
Predicted Effect probably damaging
Transcript: ENSMUST00000025234
AA Change: K350N

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025234
Gene: ENSMUSG00000024376
AA Change: K350N

DomainStartEndE-ValueType
B41 7 211 3.32e-78 SMART
FERM_C 215 303 1.48e-28 SMART
FA 310 357 2.25e-10 SMART
low complexity region 468 494 N/A INTRINSIC
low complexity region 533 543 N/A INTRINSIC
low complexity region 589 606 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the band 4.1 protein superfamily. Members of this superfamily are thought to play an important role in regulating interactions between the cytoskeleton and plasma membrane, and contain an amino terminal conserved domain that binds glycophorin C. This gene product is thought to be involved in the beta-catenin signaling pathway. [provided by RefSeq, Dec 2016]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210010C04Rik C A 6: 41,033,193 R69L probably benign Het
Adamts5 A T 16: 85,899,966 L101Q probably damaging Het
Arhgap18 A T 10: 26,870,011 I293F possibly damaging Het
Atp8b1 T A 18: 64,545,275 Q850L probably damaging Het
B4galnt3 A T 6: 120,225,187 F118Y probably benign Het
Bcl6 A G 16: 23,971,413 probably null Het
Cc2d2b T A 19: 40,756,530 L31Q probably benign Het
Cd5l G T 3: 87,367,855 E234* probably null Het
Cfap65 T C 1: 74,926,625 T409A probably benign Het
Chst5 A T 8: 111,890,925 I21N probably benign Het
Cldn20 T C 17: 3,532,755 Y68H probably benign Het
Col4a4 T C 1: 82,528,793 M269V unknown Het
Dgkh A G 14: 78,595,145 probably null Het
Dpp6 A G 5: 27,451,244 T166A probably benign Het
Drosha A G 15: 12,881,645 D754G probably damaging Het
Fsd1 T G 17: 55,988,150 D46E probably benign Het
Gabra1 T C 11: 42,133,591 D419G probably damaging Het
Golga4 T A 9: 118,548,702 D458E probably damaging Het
Grm6 C A 11: 50,851,542 A134E probably benign Het
Ikzf1 T A 11: 11,748,339 S63R probably damaging Het
Ilvbl G A 10: 78,576,666 V74I probably benign Het
Kcng2 C T 18: 80,296,090 V328M probably benign Het
Kpna7 T C 5: 145,005,045 E145G probably benign Het
Krt81 A G 15: 101,459,567 V428A probably damaging Het
Lalba T C 15: 98,482,668 M2V probably benign Het
Lrpprc T C 17: 84,776,947 S113G probably benign Het
Mboat1 A C 13: 30,226,306 M249L probably benign Het
Meltf T C 16: 31,883,794 V113A probably damaging Het
Muc16 T A 9: 18,660,242 H327L unknown Het
Myh1 A G 11: 67,215,922 I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 66,860,548 probably benign Het
Naga C A 15: 82,330,147 V388L probably benign Het
Nfkb1 A C 3: 135,585,401 M957R possibly damaging Het
Nol12 C A 15: 78,940,593 S157* probably null Het
Olfr1000 A G 2: 85,608,407 F168L possibly damaging Het
Olfr1038-ps A T 2: 86,122,496 D191V possibly damaging Het
Olfr272 A G 4: 52,911,368 V142A possibly damaging Het
Pcdhga5 T C 18: 37,695,045 V182A probably benign Het
Pik3r4 A G 9: 105,669,882 E953G probably damaging Het
Piwil2 C T 14: 70,394,057 R646Q probably damaging Het
Plxnc1 T C 10: 94,944,109 H157R probably damaging Het
Prrg4 A T 2: 104,839,378 F131L probably benign Het
Rab28 A G 5: 41,707,970 S4P probably damaging Het
Ranbp2 C A 10: 58,455,438 Q209K probably benign Het
Schip1 G A 3: 68,064,984 D15N probably benign Het
Serpina3f T G 12: 104,218,218 M207R probably benign Het
Sgsm1 A T 5: 113,274,327 M487K possibly damaging Het
Sh3tc2 A T 18: 61,989,580 I471F probably benign Het
Slamf1 G A 1: 171,774,899 V65I possibly damaging Het
Slit3 T C 11: 35,684,044 C1062R probably damaging Het
Snapc4 T G 2: 26,373,434 K344N probably damaging Het
Sorl1 A G 9: 41,984,526 Y1778H probably damaging Het
Spon2 G A 5: 33,215,675 R228C probably damaging Het
Sv2c A G 13: 95,976,695 I582T possibly damaging Het
Tamm41 C T 6: 115,016,178 V205M probably damaging Het
Tmem2 C T 19: 21,829,957 L917F probably benign Het
Trpm2 T C 10: 77,925,789 D1009G probably benign Het
Trpm6 T C 19: 18,854,249 S1493P probably damaging Het
Ttc34 G A 4: 154,839,274 V147I possibly damaging Het
Uba2 C T 7: 34,150,850 A393T probably damaging Het
Ubn2 T A 6: 38,463,938 N416K probably benign Het
Uevld T C 7: 46,943,805 N233S probably benign Het
Upp2 G A 2: 58,774,148 M142I possibly damaging Het
Vps52 T A 17: 33,962,134 V450D probably benign Het
Wdr31 A T 4: 62,460,636 F118Y probably damaging Het
Zcchc6 A G 13: 59,799,682 F942L probably benign Het
Zfp110 T A 7: 12,848,995 D523E possibly damaging Het
Zfp367 A T 13: 64,145,643 V143D probably damaging Het
Zfp950 T C 19: 61,119,941 I235V probably benign Het
Other mutations in Epb41l4a
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01391:Epb41l4a APN 18 33801625 missense possibly damaging 0.95
IGL02942:Epb41l4a APN 18 33874201 missense probably damaging 1.00
IGL03051:Epb41l4a APN 18 33874772 missense probably damaging 1.00
IGL03236:Epb41l4a APN 18 33810219 missense probably damaging 0.98
PIT1430001:Epb41l4a UTSW 18 33797347 missense probably damaging 1.00
R0147:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0148:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R0437:Epb41l4a UTSW 18 33880273 missense probably damaging 1.00
R1511:Epb41l4a UTSW 18 33832664 missense probably benign 0.01
R1666:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1668:Epb41l4a UTSW 18 33921909 missense probably damaging 1.00
R1750:Epb41l4a UTSW 18 33828208 nonsense probably null
R2022:Epb41l4a UTSW 18 33921840 missense probably benign 0.00
R2047:Epb41l4a UTSW 18 33828206 missense probably benign 0.00
R2133:Epb41l4a UTSW 18 33874195 missense probably damaging 1.00
R3741:Epb41l4a UTSW 18 33828102 critical splice donor site probably null
R4393:Epb41l4a UTSW 18 33891420 splice site probably null
R4700:Epb41l4a UTSW 18 33802507 splice site probably null
R4878:Epb41l4a UTSW 18 33798572 missense probably damaging 1.00
R5226:Epb41l4a UTSW 18 33810313 missense probably damaging 1.00
R5284:Epb41l4a UTSW 18 33798800 missense probably damaging 0.98
R5584:Epb41l4a UTSW 18 33854271 missense probably damaging 1.00
R5945:Epb41l4a UTSW 18 33828730 missense possibly damaging 0.89
R6005:Epb41l4a UTSW 18 33828143 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6038:Epb41l4a UTSW 18 33854335 missense probably benign
R6177:Epb41l4a UTSW 18 33798815 splice site probably null
R6188:Epb41l4a UTSW 18 33832665 missense probably benign
R6314:Epb41l4a UTSW 18 33874155 missense probably damaging 1.00
R6552:Epb41l4a UTSW 18 33878979 missense probably damaging 1.00
R7605:Epb41l4a UTSW 18 33797451 missense probably damaging 0.99
R7665:Epb41l4a UTSW 18 34006016 missense possibly damaging 0.92
R7729:Epb41l4a UTSW 18 33854273 missense probably damaging 1.00
R7802:Epb41l4a UTSW 18 33828174 missense probably benign 0.19
R7857:Epb41l4a UTSW 18 34006045 nonsense probably null
R8281:Epb41l4a UTSW 18 33878945 missense probably damaging 1.00
X0028:Epb41l4a UTSW 18 33802537 missense probably benign 0.23
Predicted Primers PCR Primer
(F):5'- ATTGCCATGTGTGTACCCTC -3'
(R):5'- AAGCCTGTATGGTTATGGCC -3'

Sequencing Primer
(F):5'- ACACATACAAACATGCGTATCACGTG -3'
(R):5'- GCAAATGAGCCGAGATCT -3'
Posted On2019-11-12