Incidental Mutation 'R7727:Atp8b1'
ID 595599
Institutional Source Beutler Lab
Gene Symbol Atp8b1
Ensembl Gene ENSMUSG00000039529
Gene Name ATPase, class I, type 8B, member 1
Synonyms Ic, FIC1
MMRRC Submission 045783-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7727 (G1)
Quality Score 225.009
Status Validated
Chromosome 18
Chromosomal Location 64662050-64794342 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 64678346 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Glutamine to Leucine at position 850 (Q850L)
Ref Sequence ENSEMBL: ENSMUSP00000025482 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000025482]
AlphaFold Q148W0
Predicted Effect probably damaging
Transcript: ENSMUST00000025482
AA Change: Q850L

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000025482
Gene: ENSMUSG00000039529
AA Change: Q850L

DomainStartEndE-ValueType
Pfam:PhoLip_ATPase_N 65 144 5.3e-29 PFAM
Pfam:E1-E2_ATPase 146 413 6e-11 PFAM
Pfam:HAD 451 902 2.4e-21 PFAM
Pfam:Cation_ATPase 532 632 1e-12 PFAM
Pfam:PhoLip_ATPase_C 919 1173 7.3e-82 PFAM
low complexity region 1193 1207 N/A INTRINSIC
low complexity region 1221 1232 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.9%
Validation Efficiency 100% (69/69)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the P-type cation transport ATPase family, which belongs to the subfamily of aminophospholipid-transporting ATPases. The aminophospholipid translocases transport phosphatidylserine and phosphatidylethanolamine from one side of a bilayer to another. Mutations in this gene may result in progressive familial intrahepatic cholestasis type 1 and in benign recurrent intrahepatic cholestasis. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous mice display abnormal bile salt homeostasis, normal bile secretion, and an impaired ability to handle increased bile salt loading resulting in liver damage and weight loss on a bile salt supplemented diet. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 69 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adamts5 A T 16: 85,696,854 (GRCm39) L101Q probably damaging Het
Arhgap18 A T 10: 26,746,007 (GRCm39) I293F possibly damaging Het
B4galnt3 A T 6: 120,202,148 (GRCm39) F118Y probably benign Het
Bcl6 A G 16: 23,790,163 (GRCm39) probably null Het
Cc2d2b T A 19: 40,744,974 (GRCm39) L31Q probably benign Het
Cd5l G T 3: 87,275,162 (GRCm39) E234* probably null Het
Cemip2 C T 19: 21,807,321 (GRCm39) L917F probably benign Het
Cfap65 T C 1: 74,965,784 (GRCm39) T409A probably benign Het
Chst5 A T 8: 112,617,557 (GRCm39) I21N probably benign Het
Cldn20 T C 17: 3,583,030 (GRCm39) Y68H probably benign Het
Col4a4 T C 1: 82,506,514 (GRCm39) M269V unknown Het
Dgkh A G 14: 78,832,585 (GRCm39) probably null Het
Dpp6 A G 5: 27,656,242 (GRCm39) T166A probably benign Het
Drosha A G 15: 12,881,731 (GRCm39) D754G probably damaging Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Fsd1 T G 17: 56,295,150 (GRCm39) D46E probably benign Het
Gabra1 T C 11: 42,024,418 (GRCm39) D419G probably damaging Het
Golga4 T A 9: 118,377,770 (GRCm39) D458E probably damaging Het
Grm6 C A 11: 50,742,369 (GRCm39) A134E probably benign Het
Ikzf1 T A 11: 11,698,339 (GRCm39) S63R probably damaging Het
Ilvbl G A 10: 78,412,500 (GRCm39) V74I probably benign Het
Kcng2 C T 18: 80,339,305 (GRCm39) V328M probably benign Het
Kpna7 T C 5: 144,941,855 (GRCm39) E145G probably benign Het
Krt81 A G 15: 101,357,448 (GRCm39) V428A probably damaging Het
Lalba T C 15: 98,380,549 (GRCm39) M2V probably benign Het
Lrpprc T C 17: 85,084,375 (GRCm39) S113G probably benign Het
Mboat1 A C 13: 30,410,289 (GRCm39) M249L probably benign Het
Meltf T C 16: 31,702,612 (GRCm39) V113A probably damaging Het
Muc16 T A 9: 18,571,538 (GRCm39) H327L unknown Het
Myh1 A G 11: 67,106,748 (GRCm39) I1277V probably benign Het
Naf1 GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC GCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCTGCCAGCCCCGAACTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAGCTCGGATCCCGGCGGAAGACCACCGCCGCCGCCAGCCCCGAACTGGGATGCGGGCGGAAGACCACCACCGCCGCCAGCCCCGAACTCGGATCCCGGCGGAAGACC 8: 67,313,200 (GRCm39) probably benign Het
Naga C A 15: 82,214,348 (GRCm39) V388L probably benign Het
Nfkb1 A C 3: 135,291,162 (GRCm39) M957R possibly damaging Het
Nol12 C A 15: 78,824,793 (GRCm39) S157* probably null Het
Or13c25 A G 4: 52,911,368 (GRCm39) V142A possibly damaging Het
Or5g23 A G 2: 85,438,751 (GRCm39) F168L possibly damaging Het
Or8u3-ps A T 2: 85,952,840 (GRCm39) D191V possibly damaging Het
Pcdhga5 T C 18: 37,828,098 (GRCm39) V182A probably benign Het
Pik3r4 A G 9: 105,547,081 (GRCm39) E953G probably damaging Het
Piwil2 C T 14: 70,631,506 (GRCm39) R646Q probably damaging Het
Plxnc1 T C 10: 94,779,971 (GRCm39) H157R probably damaging Het
Prrg4 A T 2: 104,669,723 (GRCm39) F131L probably benign Het
Prss3b C A 6: 41,010,127 (GRCm39) R69L probably benign Het
Rab28 A G 5: 41,865,313 (GRCm39) S4P probably damaging Het
Ranbp2 C A 10: 58,291,260 (GRCm39) Q209K probably benign Het
Schip1 G A 3: 67,972,317 (GRCm39) D15N probably benign Het
Serpina3f T G 12: 104,184,477 (GRCm39) M207R probably benign Het
Sgsm1 A T 5: 113,422,193 (GRCm39) M487K possibly damaging Het
Sh3tc2 A T 18: 62,122,651 (GRCm39) I471F probably benign Het
Slamf1 G A 1: 171,602,467 (GRCm39) V65I possibly damaging Het
Slit3 T C 11: 35,574,871 (GRCm39) C1062R probably damaging Het
Snapc4 T G 2: 26,263,446 (GRCm39) K344N probably damaging Het
Sorl1 A G 9: 41,895,822 (GRCm39) Y1778H probably damaging Het
Spon2 G A 5: 33,373,019 (GRCm39) R228C probably damaging Het
Sv2c A G 13: 96,113,203 (GRCm39) I582T possibly damaging Het
Tamm41 C T 6: 114,993,139 (GRCm39) V205M probably damaging Het
Trpm2 T C 10: 77,761,623 (GRCm39) D1009G probably benign Het
Trpm6 T C 19: 18,831,613 (GRCm39) S1493P probably damaging Het
Ttc34 G A 4: 154,923,731 (GRCm39) V147I possibly damaging Het
Tut7 A G 13: 59,947,496 (GRCm39) F942L probably benign Het
Uba2 C T 7: 33,850,275 (GRCm39) A393T probably damaging Het
Ubn2 T A 6: 38,440,873 (GRCm39) N416K probably benign Het
Uevld T C 7: 46,593,553 (GRCm39) N233S probably benign Het
Upp2 G A 2: 58,664,160 (GRCm39) M142I possibly damaging Het
Vps52 T A 17: 34,181,108 (GRCm39) V450D probably benign Het
Wdr31 A T 4: 62,378,873 (GRCm39) F118Y probably damaging Het
Zfp110 T A 7: 12,582,922 (GRCm39) D523E possibly damaging Het
Zfp367 A T 13: 64,293,457 (GRCm39) V143D probably damaging Het
Zfp950 T C 19: 61,108,379 (GRCm39) I235V probably benign Het
Other mutations in Atp8b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00472:Atp8b1 APN 18 64,697,501 (GRCm39) missense probably benign 0.23
IGL00907:Atp8b1 APN 18 64,694,776 (GRCm39) missense possibly damaging 0.95
IGL00962:Atp8b1 APN 18 64,664,515 (GRCm39) missense probably damaging 1.00
IGL01433:Atp8b1 APN 18 64,706,590 (GRCm39) missense probably benign 0.00
IGL01525:Atp8b1 APN 18 64,672,323 (GRCm39) nonsense probably null
IGL01645:Atp8b1 APN 18 64,679,184 (GRCm39) missense probably benign 0.06
IGL02008:Atp8b1 APN 18 64,671,766 (GRCm39) splice site probably benign
IGL02227:Atp8b1 APN 18 64,695,261 (GRCm39) missense probably benign
IGL02231:Atp8b1 APN 18 64,683,455 (GRCm39) missense possibly damaging 0.94
IGL02326:Atp8b1 APN 18 64,671,654 (GRCm39) missense probably damaging 0.99
IGL02562:Atp8b1 APN 18 64,715,057 (GRCm39) missense probably benign
IGL02929:Atp8b1 APN 18 64,694,733 (GRCm39) missense possibly damaging 0.63
enchilada UTSW 18 64,679,060 (GRCm39) critical splice donor site probably null
PIT4520001:Atp8b1 UTSW 18 64,701,251 (GRCm39) missense probably benign 0.34
PIT4696001:Atp8b1 UTSW 18 64,672,341 (GRCm39) missense possibly damaging 0.93
R0144:Atp8b1 UTSW 18 64,704,445 (GRCm39) splice site probably benign
R0193:Atp8b1 UTSW 18 64,694,707 (GRCm39) missense probably benign
R0277:Atp8b1 UTSW 18 64,701,323 (GRCm39) missense possibly damaging 0.94
R0308:Atp8b1 UTSW 18 64,678,315 (GRCm39) nonsense probably null
R0323:Atp8b1 UTSW 18 64,701,323 (GRCm39) missense possibly damaging 0.94
R0403:Atp8b1 UTSW 18 64,673,381 (GRCm39) missense probably damaging 1.00
R0601:Atp8b1 UTSW 18 64,704,724 (GRCm39) splice site probably null
R0614:Atp8b1 UTSW 18 64,666,658 (GRCm39) splice site probably benign
R0883:Atp8b1 UTSW 18 64,697,612 (GRCm39) missense probably benign 0.44
R1077:Atp8b1 UTSW 18 64,706,333 (GRCm39) nonsense probably null
R1292:Atp8b1 UTSW 18 64,704,092 (GRCm39) missense probably damaging 0.99
R1494:Atp8b1 UTSW 18 64,697,597 (GRCm39) missense probably damaging 1.00
R1522:Atp8b1 UTSW 18 64,683,503 (GRCm39) missense probably benign 0.00
R1534:Atp8b1 UTSW 18 64,678,335 (GRCm39) missense probably damaging 1.00
R1535:Atp8b1 UTSW 18 64,678,335 (GRCm39) missense probably damaging 1.00
R1536:Atp8b1 UTSW 18 64,678,335 (GRCm39) missense probably damaging 1.00
R1537:Atp8b1 UTSW 18 64,678,335 (GRCm39) missense probably damaging 1.00
R1650:Atp8b1 UTSW 18 64,704,620 (GRCm39) splice site probably benign
R1772:Atp8b1 UTSW 18 64,706,563 (GRCm39) missense possibly damaging 0.88
R2016:Atp8b1 UTSW 18 64,673,405 (GRCm39) missense probably damaging 1.00
R2017:Atp8b1 UTSW 18 64,673,405 (GRCm39) missense probably damaging 1.00
R2043:Atp8b1 UTSW 18 64,738,271 (GRCm39) missense possibly damaging 0.94
R2223:Atp8b1 UTSW 18 64,697,428 (GRCm39) missense possibly damaging 0.88
R3052:Atp8b1 UTSW 18 64,686,179 (GRCm39) missense probably benign 0.04
R3694:Atp8b1 UTSW 18 64,666,792 (GRCm39) missense possibly damaging 0.81
R3738:Atp8b1 UTSW 18 64,666,800 (GRCm39) splice site probably benign
R4211:Atp8b1 UTSW 18 64,686,118 (GRCm39) missense probably damaging 1.00
R4362:Atp8b1 UTSW 18 64,697,608 (GRCm39) missense probably damaging 1.00
R4560:Atp8b1 UTSW 18 64,701,318 (GRCm39) missense probably benign 0.11
R4560:Atp8b1 UTSW 18 64,689,950 (GRCm39) nonsense probably null
R4562:Atp8b1 UTSW 18 64,689,962 (GRCm39) missense probably damaging 1.00
R4615:Atp8b1 UTSW 18 64,686,170 (GRCm39) missense probably null
R4676:Atp8b1 UTSW 18 64,671,749 (GRCm39) missense probably benign 0.01
R4738:Atp8b1 UTSW 18 64,678,251 (GRCm39) missense probably benign 0.31
R4774:Atp8b1 UTSW 18 64,666,730 (GRCm39) missense possibly damaging 0.49
R4808:Atp8b1 UTSW 18 64,694,782 (GRCm39) missense probably benign 0.01
R4868:Atp8b1 UTSW 18 64,684,937 (GRCm39) missense probably damaging 1.00
R5162:Atp8b1 UTSW 18 64,694,733 (GRCm39) missense possibly damaging 0.63
R5289:Atp8b1 UTSW 18 64,679,158 (GRCm39) missense possibly damaging 0.51
R5328:Atp8b1 UTSW 18 64,664,462 (GRCm39) missense probably benign 0.00
R5400:Atp8b1 UTSW 18 64,679,060 (GRCm39) critical splice donor site probably null
R5587:Atp8b1 UTSW 18 64,672,281 (GRCm39) missense probably damaging 1.00
R5623:Atp8b1 UTSW 18 64,679,165 (GRCm39) missense possibly damaging 0.85
R5651:Atp8b1 UTSW 18 64,664,453 (GRCm39) missense probably benign 0.31
R5652:Atp8b1 UTSW 18 64,664,453 (GRCm39) missense probably benign 0.31
R5653:Atp8b1 UTSW 18 64,678,268 (GRCm39) missense probably damaging 1.00
R5667:Atp8b1 UTSW 18 64,714,994 (GRCm39) missense probably damaging 1.00
R5689:Atp8b1 UTSW 18 64,697,608 (GRCm39) missense probably damaging 1.00
R6008:Atp8b1 UTSW 18 64,710,687 (GRCm39) missense probably damaging 1.00
R6315:Atp8b1 UTSW 18 64,664,550 (GRCm39) missense probably damaging 0.97
R6759:Atp8b1 UTSW 18 64,679,161 (GRCm39) missense probably benign 0.00
R6850:Atp8b1 UTSW 18 64,689,923 (GRCm39) missense possibly damaging 0.94
R7255:Atp8b1 UTSW 18 64,689,939 (GRCm39) missense probably damaging 1.00
R7606:Atp8b1 UTSW 18 64,688,186 (GRCm39) missense probably damaging 1.00
R7635:Atp8b1 UTSW 18 64,706,376 (GRCm39) missense possibly damaging 0.59
R7639:Atp8b1 UTSW 18 64,697,614 (GRCm39) missense possibly damaging 0.91
R7698:Atp8b1 UTSW 18 64,704,093 (GRCm39) missense probably benign 0.03
R7779:Atp8b1 UTSW 18 64,674,453 (GRCm39) missense probably damaging 1.00
R7785:Atp8b1 UTSW 18 64,689,921 (GRCm39) missense probably damaging 1.00
R7874:Atp8b1 UTSW 18 64,704,095 (GRCm39) missense probably benign 0.30
R7990:Atp8b1 UTSW 18 64,671,748 (GRCm39) missense possibly damaging 0.91
R8020:Atp8b1 UTSW 18 64,679,084 (GRCm39) missense probably damaging 1.00
R8161:Atp8b1 UTSW 18 64,690,058 (GRCm39) missense probably damaging 1.00
R9007:Atp8b1 UTSW 18 64,684,931 (GRCm39) missense probably benign 0.40
R9064:Atp8b1 UTSW 18 64,697,491 (GRCm39) missense probably benign 0.12
R9266:Atp8b1 UTSW 18 64,710,528 (GRCm39) missense possibly damaging 0.70
R9266:Atp8b1 UTSW 18 64,704,108 (GRCm39) missense probably benign 0.08
R9326:Atp8b1 UTSW 18 64,706,344 (GRCm39) missense probably damaging 1.00
X0025:Atp8b1 UTSW 18 64,704,476 (GRCm39) nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCACAAGCCACCTTCGTAC -3'
(R):5'- CTTCCCAGGACTCAAATCTTGG -3'

Sequencing Primer
(F):5'- CGTACAACTCACTTTTGATCATGTTG -3'
(R):5'- ACTCAAATCTTGGGAGTGGTACTC -3'
Posted On 2019-11-12