Mutagenetix > Incidental Mutation

Incidental Mutation 'R7728:Shroom3'

595620

Institutional Source

Beutler Lab

Gene Symbol

Shroom3

Ensembl Gene

ENSMUSG00000029381

Gene Name

shroom family member 3

Synonyms

D5Ertd287e, Shrm3, Shrm

MMRRC Submission

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R7728 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

92683435-92965318 bp(+) (GRCm38)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 92683707 bp (GRCm38)

Zygosity

Heterozygous

Amino Acid Change

Proline to Glutamine at position 14 (P14Q)

Ref Sequence

ENSEMBL: ENSMUSP00000108678 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000113055] [ENSMUST00000168878]

AlphaFold

no structure available at present

Predicted Effect

possibly damaging
Transcript: ENSMUST00000113055
AA Change: P14Q

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)

SMART Domains

Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: P14Q

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
Pfam:ASD1	882	1060	1e-57	PFAM
low complexity region	1114	1127	N/A	INTRINSIC
low complexity region	1307	1318	N/A	INTRINSIC
low complexity region	1347	1359	N/A	INTRINSIC
low complexity region	1449	1463	N/A	INTRINSIC
low complexity region	1508	1520	N/A	INTRINSIC
Pfam:ASD2	1654	1940	9.9e-112	PFAM

Predicted Effect

possibly damaging
Transcript: ENSMUST00000168878
AA Change: P14Q

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)

SMART Domains

Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: P14Q

Domain	Start	End	E-Value	Type
PDZ	35	109	5.81e-11	SMART
low complexity region	191	202	N/A	INTRINSIC
low complexity region	258	268	N/A	INTRINSIC
low complexity region	747	761	N/A	INTRINSIC
low complexity region	796	814	N/A	INTRINSIC
low complexity region	860	879	N/A	INTRINSIC
low complexity region	983	996	N/A	INTRINSIC
low complexity region	1176	1187	N/A	INTRINSIC
low complexity region	1216	1228	N/A	INTRINSIC
low complexity region	1318	1332	N/A	INTRINSIC
low complexity region	1377	1389	N/A	INTRINSIC
Pfam:ASD2	1522	1809	8.9e-108	PFAM

Coding Region Coverage

1x: 100.0%
3x: 99.9%
10x: 99.6%
20x: 99.0%

Validation Efficiency

100% (66/66)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 67 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
1700017B05Rik	G	A	9: 57,256,539	P851S	probably damaging	Het
2210408I21Rik	T	A	13: 77,316,477	L931Q	possibly damaging	Het
Abcg3	T	G	5: 104,936,078	I609L	probably benign	Het
Acly	A	T	11: 100,516,797	F242L	probably damaging	Het
Acly	C	T	11: 100,519,687	G155D	probably benign	Het
Acsl5	T	A	19: 55,287,853	L370*	probably null	Het
Arhgef17	G	A	7: 100,930,068	P558S	probably benign	Het
Bhlha9	T	A	11: 76,673,089	S181T	possibly damaging	Het
Birc6	A	G	17: 74,622,105	T2331A	probably benign	Het
C1ra	G	A	6: 124,517,725	E316K	probably benign	Het
C530008M17Rik	T	C	5: 76,857,469	V559A	unknown	Het
Ccdc7b	A	T	8: 129,072,690	R83W	unknown	Het
Churc1	T	A	12: 76,773,278	N20K	probably benign	Het
Clec9a	T	C	6: 129,415,235	S63P	possibly damaging	Het
Cndp2	T	A	18: 84,672,077	M247L	probably benign	Het
Cpvl	C	T	6: 53,925,290	S329N	probably benign	Het
Csmd1	A	T	8: 16,231,271	W747R	probably damaging	Het
Dhx40	A	T	11: 86,771,933	D644E	probably damaging	Het
Disp2	A	T	2: 118,791,480	N898Y	probably benign	Het
Dnah3	G	A	7: 119,938,828	H666Y	probably damaging	Het
Dnajc2	C	T	5: 21,770,540	D222N	possibly damaging	Het
Epha5	A	T	5: 84,067,408	M826K	possibly damaging	Het
Fam13a	T	C	6: 58,954,299	D432G	possibly damaging	Het
Fkbp6	A	G	5: 135,339,544	L276P	probably damaging	Het
Gars	G	T	6: 55,050,386	W155L	probably damaging	Het
Gm12258	C	A	11: 58,859,692	H564Q	unknown	Het
Gm3127	A	G	14: 4,166,059	D79G	possibly damaging	Het
Gm6614	C	A	6: 141,987,710	E470*	probably null	Het
H2-Q10	T	A	17: 35,470,838	I119N	probably damaging	Het
Harbi1	A	G	2: 91,712,281	D29G	possibly damaging	Het
Hp1bp3	T	A	4: 138,225,996	M155K	probably damaging	Het
Itpr3	T	G	17: 27,098,114	M781R	probably damaging	Het
Kat7	T	C	11: 95,300,081	K101E	probably benign	Het
Kif7	A	G	7: 79,710,730	I299T	possibly damaging	Het
Krt34	A	G	11: 100,039,985		probably null	Het
Krt81	A	G	15: 101,460,206	Y389H	probably damaging	Het
Lrrc36	A	T	8: 105,449,498	E168V	probably benign	Het
Lrrk1	A	G	7: 66,262,715	V1699A	probably benign	Het
Mdh1b	T	A	1: 63,715,270	S380C	probably benign	Het
Mlkl	A	G	8: 111,333,619	L45P	probably damaging	Het
Mmp13	T	A	9: 7,274,004	D159E	probably benign	Het
Nanp	A	G	2: 151,030,915	V31A	possibly damaging	Het
Nbeal1	T	C	1: 60,244,824	S846P	probably damaging	Het
Neb	G	A	2: 52,183,299	R5982C	probably damaging	Het
Nebl	G	T	2: 17,370,514	F93L		Het
Olfr745	G	A	14: 50,642,392	G31E	probably benign	Het
Pcdhb11	A	T	18: 37,423,477	N620I	probably damaging	Het
Pcdhgb2	A	G	18: 37,691,207	Y417C	probably damaging	Het
Pwp2	T	C	10: 78,178,561	T402A	probably benign	Het
Ralgapb	T	C	2: 158,482,503		probably null	Het
Rexo4	G	A	2: 26,964,230	A30V	probably benign	Het
Rrs1	T	A	1: 9,546,398	M292K	possibly damaging	Het
Slc16a10	T	A	10: 40,040,758	I383F	probably damaging	Het
Slk	C	A	19: 47,620,816	P736Q	probably damaging	Het
St6galnac2	T	A	11: 116,679,985	H259L	probably benign	Het
Stambpl1	T	G	19: 34,236,321	S317A	possibly damaging	Het
Syvn1	A	G	19: 6,051,205	T429A	unknown	Het
Tbc1d9	A	T	8: 83,259,350	E828V	probably damaging	Het
Tmtc2	A	C	10: 105,271,497		probably null	Het
Trmt11	A	G	10: 30,587,501	I206T	possibly damaging	Het
Trp53bp1	A	C	2: 121,207,899	L1436R	probably damaging	Het
Ttll5	C	T	12: 85,956,632	R1095W	probably benign	Het
Utp20	A	G	10: 88,798,341	F831S	probably damaging	Het
Vmn2r109	T	A	17: 20,552,855	Q501H	probably damaging	Het
Zcchc17	A	G	4: 130,337,019		probably null	Het
Zfhx3	A	G	8: 108,951,569	M3084V	probably benign	Het
Zfp81	T	C	17: 33,336,817	N12S	possibly damaging	Het

Other mutations in Shroom3

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00850:Shroom3	APN	5	92951065	missense	probably damaging	1.00
IGL01086:Shroom3	APN	5	92948452	missense	probably benign	0.01
IGL01363:Shroom3	APN	5	92940993	missense	probably benign	0.01
IGL01468:Shroom3	APN	5	92940342	missense	probably damaging	1.00
IGL01675:Shroom3	APN	5	92941680	missense	probably damaging	0.99
IGL01862:Shroom3	APN	5	92962289	missense	probably damaging	1.00
IGL01987:Shroom3	APN	5	92942189	missense	probably damaging	0.99
IGL02104:Shroom3	APN	5	92940389	missense	probably benign	0.32
IGL03248:Shroom3	APN	5	92952540	missense	probably benign	0.00
IGL03386:Shroom3	APN	5	92948483	splice site	probably benign
R0167:Shroom3	UTSW	5	92948395	splice site	probably benign
R0388:Shroom3	UTSW	5	92951293	missense	probably benign	0.39
R0395:Shroom3	UTSW	5	92780903	missense	probably damaging	1.00
R0567:Shroom3	UTSW	5	92964453	missense	possibly damaging	0.53
R1496:Shroom3	UTSW	5	92942834	missense	possibly damaging	0.69
R1772:Shroom3	UTSW	5	92940656	missense	probably damaging	0.97
R1845:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R1921:Shroom3	UTSW	5	92962365	critical splice donor site	probably null
R2059:Shroom3	UTSW	5	92683784	missense	probably damaging	1.00
R2203:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2301:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2344:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2345:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2346:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2348:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2371:Shroom3	UTSW	5	92780870	missense	probably damaging	1.00
R2435:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2829:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2830:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2831:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2897:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R2898:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3080:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3433:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3729:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3730:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3735:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3736:Shroom3	UTSW	5	92964444	missense	possibly damaging	0.84
R3851:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3852:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3943:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R3969:Shroom3	UTSW	5	92940879	missense	probably benign	0.05
R4008:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4009:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4012:Shroom3	UTSW	5	92948483	splice site	probably benign
R4154:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4157:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4172:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4173:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4201:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4202:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4204:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4205:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4206:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4284:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4285:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4364:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4384:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4456:Shroom3	UTSW	5	92940999	missense	probably benign	0.14
R4707:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4712:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4751:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4755:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4760:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4773:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4774:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4776:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4801:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4802:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4856:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4857:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4860:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4882:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R4883:Shroom3	UTSW	5	92951134	missense	probably benign	0.14
R4886:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R5262:Shroom3	UTSW	5	92964573	missense	probably damaging	1.00
R5271:Shroom3	UTSW	5	92962248	missense	probably damaging	1.00
R5719:Shroom3	UTSW	5	92943018	missense	probably benign	0.04
R5726:Shroom3	UTSW	5	92943005	missense	probably benign	0.00
R5993:Shroom3	UTSW	5	92940188	missense	probably damaging	1.00
R6078:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6079:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6138:Shroom3	UTSW	5	92943086	missense	probably damaging	1.00
R6153:Shroom3	UTSW	5	92964408	missense	probably damaging	0.99
R6493:Shroom3	UTSW	5	92941561	missense	probably benign	0.03
R6495:Shroom3	UTSW	5	92942069	missense	possibly damaging	0.66
R6693:Shroom3	UTSW	5	92940758	missense	possibly damaging	0.61
R6801:Shroom3	UTSW	5	92940936	missense	probably damaging	1.00
R6893:Shroom3	UTSW	5	92942204	missense	probably damaging	0.97
R6912:Shroom3	UTSW	5	92943017	missense	probably benign	0.02
R6924:Shroom3	UTSW	5	92964403	missense	probably damaging	1.00
R7083:Shroom3	UTSW	5	92964525	missense	probably damaging	1.00
R7197:Shroom3	UTSW	5	92942604	missense	probably damaging	1.00
R7366:Shroom3	UTSW	5	92964606	nonsense	probably null
R7712:Shroom3	UTSW	5	92950947	missense	probably benign	0.01
R7725:Shroom3	UTSW	5	92941653	missense	probably benign	0.19
R7774:Shroom3	UTSW	5	92950489	missense	probably damaging	0.98
R7795:Shroom3	UTSW	5	92919649	missense	probably damaging	0.99
R7821:Shroom3	UTSW	5	92940846	missense	probably damaging	0.98
R7971:Shroom3	UTSW	5	92951074	missense	probably damaging	1.00
R8276:Shroom3	UTSW	5	92940480	missense	probably damaging	0.99
R8934:Shroom3	UTSW	5	92941725	missense	probably damaging	1.00
R8938:Shroom3	UTSW	5	92943071	missense	probably damaging	1.00
R9083:Shroom3	UTSW	5	92950674	missense	probably damaging	0.97
R9108:Shroom3	UTSW	5	92940116	missense	probably damaging	1.00
R9124:Shroom3	UTSW	5	92964542	missense	probably benign	0.19
R9295:Shroom3	UTSW	5	92950619	missense	probably benign	0.00

Predicted Primers

PCR Primer
(F):5'- TGTGAACGCAGTGGGTAGAC -3'
(R):5'- CCACAAGTTGGTTGCAGAC -3'

Sequencing Primer
(F):5'- GGACTTCCGCTGAATTCCAG -3'
(R):5'- CACAAGTTGGTTGCAGACAATACTG -3'

Posted On

2019-11-12