Incidental Mutation 'R7728:Shroom3'
ID595620
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Nameshroom family member 3
SynonymsD5Ertd287e, Shrm3, Shrm
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7728 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location92683435-92965318 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 92683707 bp
ZygosityHeterozygous
Amino Acid Change Proline to Glutamine at position 14 (P14Q)
Ref Sequence ENSEMBL: ENSMUSP00000108678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113055] [ENSMUST00000168878]
Predicted Effect possibly damaging
Transcript: ENSMUST00000113055
AA Change: P14Q

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: P14Q

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168878
AA Change: P14Q

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: P14Q

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,256,539 P851S probably damaging Het
2210408I21Rik T A 13: 77,316,477 L931Q possibly damaging Het
Abcg3 T G 5: 104,936,078 I609L probably benign Het
Acly A T 11: 100,516,797 F242L probably damaging Het
Acly C T 11: 100,519,687 G155D probably benign Het
Acsl5 T A 19: 55,287,853 L370* probably null Het
Arhgef17 G A 7: 100,930,068 P558S probably benign Het
Bhlha9 T A 11: 76,673,089 S181T possibly damaging Het
Birc6 A G 17: 74,622,105 T2331A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik T C 5: 76,857,469 V559A unknown Het
Ccdc7b A T 8: 129,072,690 R83W unknown Het
Churc1 T A 12: 76,773,278 N20K probably benign Het
Clec9a T C 6: 129,415,235 S63P possibly damaging Het
Cndp2 T A 18: 84,672,077 M247L probably benign Het
Cpvl C T 6: 53,925,290 S329N probably benign Het
Csmd1 A T 8: 16,231,271 W747R probably damaging Het
Dhx40 A T 11: 86,771,933 D644E probably damaging Het
Disp2 A T 2: 118,791,480 N898Y probably benign Het
Dnah3 G A 7: 119,938,828 H666Y probably damaging Het
Dnajc2 C T 5: 21,770,540 D222N possibly damaging Het
Epha5 A T 5: 84,067,408 M826K possibly damaging Het
Fam13a T C 6: 58,954,299 D432G possibly damaging Het
Fkbp6 A G 5: 135,339,544 L276P probably damaging Het
Gars G T 6: 55,050,386 W155L probably damaging Het
Gm12258 C A 11: 58,859,692 H564Q unknown Het
Gm3127 A G 14: 4,166,059 D79G possibly damaging Het
Gm6614 C A 6: 141,987,710 E470* probably null Het
H2-Q10 T A 17: 35,470,838 I119N probably damaging Het
Harbi1 A G 2: 91,712,281 D29G possibly damaging Het
Hp1bp3 T A 4: 138,225,996 M155K probably damaging Het
Itpr3 T G 17: 27,098,114 M781R probably damaging Het
Kat7 T C 11: 95,300,081 K101E probably benign Het
Kif7 A G 7: 79,710,730 I299T possibly damaging Het
Krt34 A G 11: 100,039,985 probably null Het
Krt81 A G 15: 101,460,206 Y389H probably damaging Het
Lrrc36 A T 8: 105,449,498 E168V probably benign Het
Lrrk1 A G 7: 66,262,715 V1699A probably benign Het
Mdh1b T A 1: 63,715,270 S380C probably benign Het
Mlkl A G 8: 111,333,619 L45P probably damaging Het
Mmp13 T A 9: 7,274,004 D159E probably benign Het
Nanp A G 2: 151,030,915 V31A possibly damaging Het
Nbeal1 T C 1: 60,244,824 S846P probably damaging Het
Neb G A 2: 52,183,299 R5982C probably damaging Het
Nebl G T 2: 17,370,514 F93L Het
Olfr745 G A 14: 50,642,392 G31E probably benign Het
Pcdhb11 A T 18: 37,423,477 N620I probably damaging Het
Pcdhgb2 A G 18: 37,691,207 Y417C probably damaging Het
Pwp2 T C 10: 78,178,561 T402A probably benign Het
Ralgapb T C 2: 158,482,503 probably null Het
Rexo4 G A 2: 26,964,230 A30V probably benign Het
Rrs1 T A 1: 9,546,398 M292K possibly damaging Het
Slc16a10 T A 10: 40,040,758 I383F probably damaging Het
Slk C A 19: 47,620,816 P736Q probably damaging Het
St6galnac2 T A 11: 116,679,985 H259L probably benign Het
Stambpl1 T G 19: 34,236,321 S317A possibly damaging Het
Syvn1 A G 19: 6,051,205 T429A unknown Het
Tbc1d9 A T 8: 83,259,350 E828V probably damaging Het
Tmtc2 A C 10: 105,271,497 probably null Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Trp53bp1 A C 2: 121,207,899 L1436R probably damaging Het
Ttll5 C T 12: 85,956,632 R1095W probably benign Het
Utp20 A G 10: 88,798,341 F831S probably damaging Het
Vmn2r109 T A 17: 20,552,855 Q501H probably damaging Het
Zcchc17 A G 4: 130,337,019 probably null Het
Zfhx3 A G 8: 108,951,569 M3084V probably benign Het
Zfp81 T C 17: 33,336,817 N12S possibly damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 92951065 missense probably damaging 1.00
IGL01086:Shroom3 APN 5 92948452 missense probably benign 0.01
IGL01363:Shroom3 APN 5 92940993 missense probably benign 0.01
IGL01468:Shroom3 APN 5 92940342 missense probably damaging 1.00
IGL01675:Shroom3 APN 5 92941680 missense probably damaging 0.99
IGL01862:Shroom3 APN 5 92962289 missense probably damaging 1.00
IGL01987:Shroom3 APN 5 92942189 missense probably damaging 0.99
IGL02104:Shroom3 APN 5 92940389 missense probably benign 0.32
IGL03248:Shroom3 APN 5 92952540 missense probably benign 0.00
IGL03386:Shroom3 APN 5 92948483 splice site probably benign
R0167:Shroom3 UTSW 5 92948395 splice site probably benign
R0388:Shroom3 UTSW 5 92951293 missense probably benign 0.39
R0395:Shroom3 UTSW 5 92780903 missense probably damaging 1.00
R0567:Shroom3 UTSW 5 92964453 missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 92942834 missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 92940656 missense probably damaging 0.97
R1845:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R1921:Shroom3 UTSW 5 92962365 critical splice donor site probably null
R2059:Shroom3 UTSW 5 92683784 missense probably damaging 1.00
R2203:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2301:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2344:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2345:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2346:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2348:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92780870 missense probably damaging 1.00
R2435:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2829:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2830:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2831:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2897:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R2898:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3080:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3433:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3729:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3730:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3735:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 92964444 missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3852:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3943:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R3969:Shroom3 UTSW 5 92940879 missense probably benign 0.05
R4008:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4009:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4012:Shroom3 UTSW 5 92948483 splice site probably benign
R4154:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4157:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4172:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4173:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4201:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4202:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4204:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4205:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4206:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4284:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4285:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4364:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4384:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4456:Shroom3 UTSW 5 92940999 missense probably benign 0.14
R4707:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4712:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4751:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4755:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4760:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4773:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4774:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4776:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4801:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4802:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4856:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4857:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4860:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4882:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R4883:Shroom3 UTSW 5 92951134 missense probably benign 0.14
R4886:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R5262:Shroom3 UTSW 5 92964573 missense probably damaging 1.00
R5271:Shroom3 UTSW 5 92962248 missense probably damaging 1.00
R5719:Shroom3 UTSW 5 92943018 missense probably benign 0.04
R5726:Shroom3 UTSW 5 92943005 missense probably benign 0.00
R5993:Shroom3 UTSW 5 92940188 missense probably damaging 1.00
R6078:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6079:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6138:Shroom3 UTSW 5 92943086 missense probably damaging 1.00
R6153:Shroom3 UTSW 5 92964408 missense probably damaging 0.99
R6493:Shroom3 UTSW 5 92941561 missense probably benign 0.03
R6495:Shroom3 UTSW 5 92942069 missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 92940758 missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 92940936 missense probably damaging 1.00
R6893:Shroom3 UTSW 5 92942204 missense probably damaging 0.97
R6912:Shroom3 UTSW 5 92943017 missense probably benign 0.02
R6924:Shroom3 UTSW 5 92964403 missense probably damaging 1.00
R7083:Shroom3 UTSW 5 92964525 missense probably damaging 1.00
R7197:Shroom3 UTSW 5 92942604 missense probably damaging 1.00
R7366:Shroom3 UTSW 5 92964606 nonsense probably null
R7712:Shroom3 UTSW 5 92950947 missense probably benign 0.01
R7725:Shroom3 UTSW 5 92941653 missense probably benign 0.19
R7774:Shroom3 UTSW 5 92950489 missense probably damaging 0.98
R7795:Shroom3 UTSW 5 92919649 missense probably damaging 0.99
R7821:Shroom3 UTSW 5 92940846 missense probably damaging 0.98
R7971:Shroom3 UTSW 5 92951074 missense probably damaging 1.00
R8276:Shroom3 UTSW 5 92940480 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TGTGAACGCAGTGGGTAGAC -3'
(R):5'- CCACAAGTTGGTTGCAGAC -3'

Sequencing Primer
(F):5'- GGACTTCCGCTGAATTCCAG -3'
(R):5'- CACAAGTTGGTTGCAGACAATACTG -3'
Posted On2019-11-12