Incidental Mutation 'R7728:Shroom3'
ID 595620
Institutional Source Beutler Lab
Gene Symbol Shroom3
Ensembl Gene ENSMUSG00000029381
Gene Name shroom family member 3
Synonyms Shrm3, D5Ertd287e, Shrm
MMRRC Submission 045784-MU
Accession Numbers
Essential gene? Essential (E-score: 1.000) question?
Stock # R7728 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 92831294-93113177 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to A at 92831566 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Glutamine at position 14 (P14Q)
Ref Sequence ENSEMBL: ENSMUSP00000108678 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000113055] [ENSMUST00000168878]
AlphaFold no structure available at present
Predicted Effect possibly damaging
Transcript: ENSMUST00000113055
AA Change: P14Q

PolyPhen 2 Score 0.726 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108678
Gene: ENSMUSG00000029381
AA Change: P14Q

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
Pfam:ASD1 882 1060 1e-57 PFAM
low complexity region 1114 1127 N/A INTRINSIC
low complexity region 1307 1318 N/A INTRINSIC
low complexity region 1347 1359 N/A INTRINSIC
low complexity region 1449 1463 N/A INTRINSIC
low complexity region 1508 1520 N/A INTRINSIC
Pfam:ASD2 1654 1940 9.9e-112 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000168878
AA Change: P14Q

PolyPhen 2 Score 0.939 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000130419
Gene: ENSMUSG00000029381
AA Change: P14Q

DomainStartEndE-ValueType
PDZ 35 109 5.81e-11 SMART
low complexity region 191 202 N/A INTRINSIC
low complexity region 258 268 N/A INTRINSIC
low complexity region 747 761 N/A INTRINSIC
low complexity region 796 814 N/A INTRINSIC
low complexity region 860 879 N/A INTRINSIC
low complexity region 983 996 N/A INTRINSIC
low complexity region 1176 1187 N/A INTRINSIC
low complexity region 1216 1228 N/A INTRINSIC
low complexity region 1318 1332 N/A INTRINSIC
low complexity region 1377 1389 N/A INTRINSIC
Pfam:ASD2 1522 1809 8.9e-108 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a PDZ-domain-containing protein that belongs to a family of Shroom-related proteins. This protein may be involved in regulating cell shape in certain tissues. A similar protein in mice is required for proper neurulation. [provided by RefSeq, Jan 2011]
PHENOTYPE: Homozygous mutation of this locus results in failed neural tube closure leading to exencephaly, acrania, facial clefting, and spina bifida. Homozygotes develop to term but die either at birth or shortly thereafter. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,163,822 (GRCm39) P851S probably damaging Het
2210408I21Rik T A 13: 77,464,596 (GRCm39) L931Q possibly damaging Het
Abcg3 T G 5: 105,083,944 (GRCm39) I609L probably benign Het
Acly A T 11: 100,407,623 (GRCm39) F242L probably damaging Het
Acly C T 11: 100,410,513 (GRCm39) G155D probably benign Het
Acsl5 T A 19: 55,276,285 (GRCm39) L370* probably null Het
Arhgef17 G A 7: 100,579,275 (GRCm39) P558S probably benign Het
Bhlha9 T A 11: 76,563,915 (GRCm39) S181T possibly damaging Het
Birc6 A G 17: 74,929,100 (GRCm39) T2331A probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Ccdc7b A T 8: 129,799,171 (GRCm39) R83W unknown Het
Churc1 T A 12: 76,820,052 (GRCm39) N20K probably benign Het
Clec9a T C 6: 129,392,198 (GRCm39) S63P possibly damaging Het
Cndp2 T A 18: 84,690,202 (GRCm39) M247L probably benign Het
Cpvl C T 6: 53,902,275 (GRCm39) S329N probably benign Het
Cracd T C 5: 77,005,316 (GRCm39) V559A unknown Het
Csmd1 A T 8: 16,281,285 (GRCm39) W747R probably damaging Het
Dhx40 A T 11: 86,662,759 (GRCm39) D644E probably damaging Het
Disp2 A T 2: 118,621,961 (GRCm39) N898Y probably benign Het
Dnah3 G A 7: 119,538,051 (GRCm39) H666Y probably damaging Het
Dnajc2 C T 5: 21,975,538 (GRCm39) D222N possibly damaging Het
Epha5 A T 5: 84,215,267 (GRCm39) M826K possibly damaging Het
Fam13a T C 6: 58,931,284 (GRCm39) D432G possibly damaging Het
Fkbp6 A G 5: 135,368,398 (GRCm39) L276P probably damaging Het
Gars1 G T 6: 55,027,371 (GRCm39) W155L probably damaging Het
Gm12258 C A 11: 58,750,518 (GRCm39) H564Q unknown Het
Gm3127 A G 14: 15,425,832 (GRCm39) D79G possibly damaging Het
H2-Q10 T A 17: 35,781,735 (GRCm39) I119N probably damaging Het
Harbi1 A G 2: 91,542,626 (GRCm39) D29G possibly damaging Het
Hp1bp3 T A 4: 137,953,307 (GRCm39) M155K probably damaging Het
Itpr3 T G 17: 27,317,088 (GRCm39) M781R probably damaging Het
Kat7 T C 11: 95,190,907 (GRCm39) K101E probably benign Het
Kif7 A G 7: 79,360,478 (GRCm39) I299T possibly damaging Het
Krt34 A G 11: 99,930,811 (GRCm39) probably null Het
Krt81 A G 15: 101,358,087 (GRCm39) Y389H probably damaging Het
Lrrc36 A T 8: 106,176,130 (GRCm39) E168V probably benign Het
Lrrk1 A G 7: 65,912,463 (GRCm39) V1699A probably benign Het
Mdh1b T A 1: 63,754,429 (GRCm39) S380C probably benign Het
Mlkl A G 8: 112,060,251 (GRCm39) L45P probably damaging Het
Mmp13 T A 9: 7,274,004 (GRCm39) D159E probably benign Het
Nanp A G 2: 150,872,835 (GRCm39) V31A possibly damaging Het
Nbeal1 T C 1: 60,283,983 (GRCm39) S846P probably damaging Het
Neb G A 2: 52,073,311 (GRCm39) R5982C probably damaging Het
Nebl G T 2: 17,375,325 (GRCm39) F93L Het
Or11h6 G A 14: 50,879,849 (GRCm39) G31E probably benign Het
Pcdhb11 A T 18: 37,556,530 (GRCm39) N620I probably damaging Het
Pcdhgb2 A G 18: 37,824,260 (GRCm39) Y417C probably damaging Het
Pwp2 T C 10: 78,014,395 (GRCm39) T402A probably benign Het
Ralgapb T C 2: 158,324,423 (GRCm39) probably null Het
Rexo4 G A 2: 26,854,242 (GRCm39) A30V probably benign Het
Rrs1 T A 1: 9,616,623 (GRCm39) M292K possibly damaging Het
Slc16a10 T A 10: 39,916,754 (GRCm39) I383F probably damaging Het
Slco1a8 C A 6: 141,933,436 (GRCm39) E470* probably null Het
Slk C A 19: 47,609,255 (GRCm39) P736Q probably damaging Het
St6galnac2 T A 11: 116,570,811 (GRCm39) H259L probably benign Het
Stambpl1 T G 19: 34,213,721 (GRCm39) S317A possibly damaging Het
Syvn1 A G 19: 6,101,235 (GRCm39) T429A unknown Het
Tbc1d9 A T 8: 83,985,979 (GRCm39) E828V probably damaging Het
Tmtc2 A C 10: 105,107,358 (GRCm39) probably null Het
Trmt11 A G 10: 30,463,497 (GRCm39) I206T possibly damaging Het
Trp53bp1 A C 2: 121,038,380 (GRCm39) L1436R probably damaging Het
Ttll5 C T 12: 86,003,406 (GRCm39) R1095W probably benign Het
Utp20 A G 10: 88,634,203 (GRCm39) F831S probably damaging Het
Vmn2r109 T A 17: 20,773,117 (GRCm39) Q501H probably damaging Het
Zcchc17 A G 4: 130,230,812 (GRCm39) probably null Het
Zfhx3 A G 8: 109,678,201 (GRCm39) M3084V probably benign Het
Zfp81 T C 17: 33,555,791 (GRCm39) N12S possibly damaging Het
Other mutations in Shroom3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00850:Shroom3 APN 5 93,098,924 (GRCm39) missense probably damaging 1.00
IGL01086:Shroom3 APN 5 93,096,311 (GRCm39) missense probably benign 0.01
IGL01363:Shroom3 APN 5 93,088,852 (GRCm39) missense probably benign 0.01
IGL01468:Shroom3 APN 5 93,088,201 (GRCm39) missense probably damaging 1.00
IGL01675:Shroom3 APN 5 93,089,539 (GRCm39) missense probably damaging 0.99
IGL01862:Shroom3 APN 5 93,110,148 (GRCm39) missense probably damaging 1.00
IGL01987:Shroom3 APN 5 93,090,048 (GRCm39) missense probably damaging 0.99
IGL02104:Shroom3 APN 5 93,088,248 (GRCm39) missense probably benign 0.32
IGL03248:Shroom3 APN 5 93,100,399 (GRCm39) missense probably benign 0.00
IGL03386:Shroom3 APN 5 93,096,342 (GRCm39) splice site probably benign
R0167:Shroom3 UTSW 5 93,096,254 (GRCm39) splice site probably benign
R0388:Shroom3 UTSW 5 93,099,152 (GRCm39) missense probably benign 0.39
R0395:Shroom3 UTSW 5 92,928,762 (GRCm39) missense probably damaging 1.00
R0567:Shroom3 UTSW 5 93,112,312 (GRCm39) missense possibly damaging 0.53
R1496:Shroom3 UTSW 5 93,090,693 (GRCm39) missense possibly damaging 0.69
R1772:Shroom3 UTSW 5 93,088,515 (GRCm39) missense probably damaging 0.97
R1845:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R1921:Shroom3 UTSW 5 93,110,224 (GRCm39) critical splice donor site probably null
R2059:Shroom3 UTSW 5 92,831,643 (GRCm39) missense probably damaging 1.00
R2203:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2301:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2344:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2345:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2346:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2348:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2371:Shroom3 UTSW 5 92,928,729 (GRCm39) missense probably damaging 1.00
R2435:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2829:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2830:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2831:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2897:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R2898:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3080:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3433:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3729:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3730:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3735:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3736:Shroom3 UTSW 5 93,112,303 (GRCm39) missense possibly damaging 0.84
R3851:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3852:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3943:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R3969:Shroom3 UTSW 5 93,088,738 (GRCm39) missense probably benign 0.05
R4008:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4009:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4012:Shroom3 UTSW 5 93,096,342 (GRCm39) splice site probably benign
R4154:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4157:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4172:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4173:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4201:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4202:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4204:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4205:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4206:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4284:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4285:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4364:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4384:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4456:Shroom3 UTSW 5 93,088,858 (GRCm39) missense probably benign 0.14
R4707:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4712:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4751:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4755:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4760:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4773:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4774:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4776:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4801:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4802:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4856:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4857:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4860:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4882:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R4883:Shroom3 UTSW 5 93,098,993 (GRCm39) missense probably benign 0.14
R4886:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R5262:Shroom3 UTSW 5 93,112,432 (GRCm39) missense probably damaging 1.00
R5271:Shroom3 UTSW 5 93,110,107 (GRCm39) missense probably damaging 1.00
R5719:Shroom3 UTSW 5 93,090,877 (GRCm39) missense probably benign 0.04
R5726:Shroom3 UTSW 5 93,090,864 (GRCm39) missense probably benign 0.00
R5993:Shroom3 UTSW 5 93,088,047 (GRCm39) missense probably damaging 1.00
R6078:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6079:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6138:Shroom3 UTSW 5 93,090,945 (GRCm39) missense probably damaging 1.00
R6153:Shroom3 UTSW 5 93,112,267 (GRCm39) missense probably damaging 0.99
R6493:Shroom3 UTSW 5 93,089,420 (GRCm39) missense probably benign 0.03
R6495:Shroom3 UTSW 5 93,089,928 (GRCm39) missense possibly damaging 0.66
R6693:Shroom3 UTSW 5 93,088,617 (GRCm39) missense possibly damaging 0.61
R6801:Shroom3 UTSW 5 93,088,795 (GRCm39) missense probably damaging 1.00
R6893:Shroom3 UTSW 5 93,090,063 (GRCm39) missense probably damaging 0.97
R6912:Shroom3 UTSW 5 93,090,876 (GRCm39) missense probably benign 0.02
R6924:Shroom3 UTSW 5 93,112,262 (GRCm39) missense probably damaging 1.00
R7083:Shroom3 UTSW 5 93,112,384 (GRCm39) missense probably damaging 1.00
R7197:Shroom3 UTSW 5 93,090,463 (GRCm39) missense probably damaging 1.00
R7366:Shroom3 UTSW 5 93,112,465 (GRCm39) nonsense probably null
R7712:Shroom3 UTSW 5 93,098,806 (GRCm39) missense probably benign 0.01
R7725:Shroom3 UTSW 5 93,089,512 (GRCm39) missense probably benign 0.19
R7774:Shroom3 UTSW 5 93,098,348 (GRCm39) missense probably damaging 0.98
R7795:Shroom3 UTSW 5 93,067,508 (GRCm39) missense probably damaging 0.99
R7821:Shroom3 UTSW 5 93,088,705 (GRCm39) missense probably damaging 0.98
R7971:Shroom3 UTSW 5 93,098,933 (GRCm39) missense probably damaging 1.00
R8276:Shroom3 UTSW 5 93,088,339 (GRCm39) missense probably damaging 0.99
R8934:Shroom3 UTSW 5 93,089,584 (GRCm39) missense probably damaging 1.00
R8938:Shroom3 UTSW 5 93,090,930 (GRCm39) missense probably damaging 1.00
R9083:Shroom3 UTSW 5 93,098,533 (GRCm39) missense probably damaging 0.97
R9108:Shroom3 UTSW 5 93,087,975 (GRCm39) missense probably damaging 1.00
R9124:Shroom3 UTSW 5 93,112,401 (GRCm39) missense probably benign 0.19
R9295:Shroom3 UTSW 5 93,098,478 (GRCm39) missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TGTGAACGCAGTGGGTAGAC -3'
(R):5'- CCACAAGTTGGTTGCAGAC -3'

Sequencing Primer
(F):5'- GGACTTCCGCTGAATTCCAG -3'
(R):5'- CACAAGTTGGTTGCAGACAATACTG -3'
Posted On 2019-11-12