Incidental Mutation 'R7728:Abcg3'
ID 595621
Institutional Source Beutler Lab
Gene Symbol Abcg3
Ensembl Gene ENSMUSG00000029299
Gene Name ATP binding cassette subfamily G member 3
Synonyms Abcp2, Mxr2
MMRRC Submission 045784-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.061) question?
Stock # R7728 (G1)
Quality Score 225.009
Status Validated
Chromosome 5
Chromosomal Location 105082923-105130584 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to G at 105083944 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Isoleucine to Leucine at position 609 (I609L)
Ref Sequence ENSEMBL: ENSMUSP00000031239 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031239] [ENSMUST00000130644]
AlphaFold Q99P81
Predicted Effect probably benign
Transcript: ENSMUST00000031239
AA Change: I609L

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000031239
Gene: ENSMUSG00000029299
AA Change: I609L

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 5.9e-9 PFAM
Pfam:ABC2_membrane 367 578 1.8e-29 PFAM
transmembrane domain 623 642 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130644
SMART Domains Protein: ENSMUSP00000120179
Gene: ENSMUSG00000029299

DomainStartEndE-ValueType
Pfam:ABC_tran 64 207 7.6e-9 PFAM
transmembrane domain 386 408 N/A INTRINSIC
Pfam:ABC2_membrane 414 548 1.9e-17 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: The protein encoded by this gene is a member of the superfamily of ATP-binding cassette (ABC) transporters. ABC proteins transport various molecules across extra- and intra-cellular membranes. ABC genes are divided into seven distinct subfamilies (ABC1, MDR/TAP, MRP, ALD, OABP, GCN20, White). This protein is a member of the White subfamily. It lacks several highly conserved residues found in other ATP-binding proteins; this suggests that this protein may not bind ATP and may require dimerization with another subunit to form a functional ATP-transporter. The function of this gene has not yet been determined; however, high levels of expression in the thymus and spleen suggest a potential role in the transport of specific peptides or hydrophobic compounds from lymphocytes. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,163,822 (GRCm39) P851S probably damaging Het
2210408I21Rik T A 13: 77,464,596 (GRCm39) L931Q possibly damaging Het
Acly A T 11: 100,407,623 (GRCm39) F242L probably damaging Het
Acly C T 11: 100,410,513 (GRCm39) G155D probably benign Het
Acsl5 T A 19: 55,276,285 (GRCm39) L370* probably null Het
Arhgef17 G A 7: 100,579,275 (GRCm39) P558S probably benign Het
Bhlha9 T A 11: 76,563,915 (GRCm39) S181T possibly damaging Het
Birc6 A G 17: 74,929,100 (GRCm39) T2331A probably benign Het
C1ra G A 6: 124,494,684 (GRCm39) E316K probably benign Het
Ccdc7b A T 8: 129,799,171 (GRCm39) R83W unknown Het
Churc1 T A 12: 76,820,052 (GRCm39) N20K probably benign Het
Clec9a T C 6: 129,392,198 (GRCm39) S63P possibly damaging Het
Cndp2 T A 18: 84,690,202 (GRCm39) M247L probably benign Het
Cpvl C T 6: 53,902,275 (GRCm39) S329N probably benign Het
Cracd T C 5: 77,005,316 (GRCm39) V559A unknown Het
Csmd1 A T 8: 16,281,285 (GRCm39) W747R probably damaging Het
Dhx40 A T 11: 86,662,759 (GRCm39) D644E probably damaging Het
Disp2 A T 2: 118,621,961 (GRCm39) N898Y probably benign Het
Dnah3 G A 7: 119,538,051 (GRCm39) H666Y probably damaging Het
Dnajc2 C T 5: 21,975,538 (GRCm39) D222N possibly damaging Het
Epha5 A T 5: 84,215,267 (GRCm39) M826K possibly damaging Het
Fam13a T C 6: 58,931,284 (GRCm39) D432G possibly damaging Het
Fkbp6 A G 5: 135,368,398 (GRCm39) L276P probably damaging Het
Gars1 G T 6: 55,027,371 (GRCm39) W155L probably damaging Het
Gm12258 C A 11: 58,750,518 (GRCm39) H564Q unknown Het
Gm3127 A G 14: 15,425,832 (GRCm39) D79G possibly damaging Het
H2-Q10 T A 17: 35,781,735 (GRCm39) I119N probably damaging Het
Harbi1 A G 2: 91,542,626 (GRCm39) D29G possibly damaging Het
Hp1bp3 T A 4: 137,953,307 (GRCm39) M155K probably damaging Het
Itpr3 T G 17: 27,317,088 (GRCm39) M781R probably damaging Het
Kat7 T C 11: 95,190,907 (GRCm39) K101E probably benign Het
Kif7 A G 7: 79,360,478 (GRCm39) I299T possibly damaging Het
Krt34 A G 11: 99,930,811 (GRCm39) probably null Het
Krt81 A G 15: 101,358,087 (GRCm39) Y389H probably damaging Het
Lrrc36 A T 8: 106,176,130 (GRCm39) E168V probably benign Het
Lrrk1 A G 7: 65,912,463 (GRCm39) V1699A probably benign Het
Mdh1b T A 1: 63,754,429 (GRCm39) S380C probably benign Het
Mlkl A G 8: 112,060,251 (GRCm39) L45P probably damaging Het
Mmp13 T A 9: 7,274,004 (GRCm39) D159E probably benign Het
Nanp A G 2: 150,872,835 (GRCm39) V31A possibly damaging Het
Nbeal1 T C 1: 60,283,983 (GRCm39) S846P probably damaging Het
Neb G A 2: 52,073,311 (GRCm39) R5982C probably damaging Het
Nebl G T 2: 17,375,325 (GRCm39) F93L Het
Or11h6 G A 14: 50,879,849 (GRCm39) G31E probably benign Het
Pcdhb11 A T 18: 37,556,530 (GRCm39) N620I probably damaging Het
Pcdhgb2 A G 18: 37,824,260 (GRCm39) Y417C probably damaging Het
Pwp2 T C 10: 78,014,395 (GRCm39) T402A probably benign Het
Ralgapb T C 2: 158,324,423 (GRCm39) probably null Het
Rexo4 G A 2: 26,854,242 (GRCm39) A30V probably benign Het
Rrs1 T A 1: 9,616,623 (GRCm39) M292K possibly damaging Het
Shroom3 C A 5: 92,831,566 (GRCm39) P14Q possibly damaging Het
Slc16a10 T A 10: 39,916,754 (GRCm39) I383F probably damaging Het
Slco1a8 C A 6: 141,933,436 (GRCm39) E470* probably null Het
Slk C A 19: 47,609,255 (GRCm39) P736Q probably damaging Het
St6galnac2 T A 11: 116,570,811 (GRCm39) H259L probably benign Het
Stambpl1 T G 19: 34,213,721 (GRCm39) S317A possibly damaging Het
Syvn1 A G 19: 6,101,235 (GRCm39) T429A unknown Het
Tbc1d9 A T 8: 83,985,979 (GRCm39) E828V probably damaging Het
Tmtc2 A C 10: 105,107,358 (GRCm39) probably null Het
Trmt11 A G 10: 30,463,497 (GRCm39) I206T possibly damaging Het
Trp53bp1 A C 2: 121,038,380 (GRCm39) L1436R probably damaging Het
Ttll5 C T 12: 86,003,406 (GRCm39) R1095W probably benign Het
Utp20 A G 10: 88,634,203 (GRCm39) F831S probably damaging Het
Vmn2r109 T A 17: 20,773,117 (GRCm39) Q501H probably damaging Het
Zcchc17 A G 4: 130,230,812 (GRCm39) probably null Het
Zfhx3 A G 8: 109,678,201 (GRCm39) M3084V probably benign Het
Zfp81 T C 17: 33,555,791 (GRCm39) N12S possibly damaging Het
Other mutations in Abcg3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00820:Abcg3 APN 5 105,083,878 (GRCm39) missense probably benign 0.02
IGL01363:Abcg3 APN 5 105,096,228 (GRCm39) missense possibly damaging 0.55
IGL02097:Abcg3 APN 5 105,109,052 (GRCm39) missense possibly damaging 0.77
IGL02554:Abcg3 APN 5 105,117,318 (GRCm39) missense possibly damaging 0.48
IGL02561:Abcg3 APN 5 105,125,536 (GRCm39) missense probably benign 0.18
IGL02974:Abcg3 APN 5 105,116,129 (GRCm39) missense probably damaging 1.00
IGL03058:Abcg3 APN 5 105,109,112 (GRCm39) missense probably benign 0.00
IGL03153:Abcg3 APN 5 105,122,631 (GRCm39) splice site probably benign
IGL03377:Abcg3 APN 5 105,096,256 (GRCm39) missense probably benign 0.01
R0110:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0469:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0510:Abcg3 UTSW 5 105,125,482 (GRCm39) missense probably damaging 0.97
R0530:Abcg3 UTSW 5 105,083,920 (GRCm39) missense probably damaging 1.00
R0579:Abcg3 UTSW 5 105,121,969 (GRCm39) missense probably damaging 1.00
R1237:Abcg3 UTSW 5 105,096,223 (GRCm39) missense probably damaging 0.96
R1505:Abcg3 UTSW 5 105,099,431 (GRCm39) missense probably damaging 1.00
R1627:Abcg3 UTSW 5 105,083,880 (GRCm39) missense probably benign 0.00
R1717:Abcg3 UTSW 5 105,111,421 (GRCm39) nonsense probably null
R1797:Abcg3 UTSW 5 105,087,030 (GRCm39) missense possibly damaging 0.66
R1899:Abcg3 UTSW 5 105,086,065 (GRCm39) missense probably damaging 0.99
R1974:Abcg3 UTSW 5 105,111,504 (GRCm39) missense probably benign 0.01
R2136:Abcg3 UTSW 5 105,114,680 (GRCm39) missense probably benign 0.04
R2285:Abcg3 UTSW 5 105,087,037 (GRCm39) missense probably damaging 1.00
R3880:Abcg3 UTSW 5 105,086,046 (GRCm39) splice site probably benign
R4242:Abcg3 UTSW 5 105,109,079 (GRCm39) missense probably benign
R4738:Abcg3 UTSW 5 105,121,849 (GRCm39) missense probably benign
R5225:Abcg3 UTSW 5 105,114,649 (GRCm39) missense probably damaging 1.00
R5309:Abcg3 UTSW 5 105,084,465 (GRCm39) missense possibly damaging 0.53
R5704:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5705:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R5785:Abcg3 UTSW 5 105,116,036 (GRCm39) missense probably damaging 0.96
R6155:Abcg3 UTSW 5 105,111,510 (GRCm39) missense probably benign 0.00
R6309:Abcg3 UTSW 5 105,117,259 (GRCm39) critical splice donor site probably null
R6814:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6872:Abcg3 UTSW 5 105,083,860 (GRCm39) missense probably benign
R6916:Abcg3 UTSW 5 105,122,601 (GRCm39) missense probably benign 0.16
R7217:Abcg3 UTSW 5 105,087,094 (GRCm39) missense possibly damaging 0.75
R7310:Abcg3 UTSW 5 105,114,632 (GRCm39) missense probably benign 0.01
R7343:Abcg3 UTSW 5 105,116,100 (GRCm39) missense probably benign 0.00
R7401:Abcg3 UTSW 5 105,114,640 (GRCm39) missense probably damaging 0.99
R7531:Abcg3 UTSW 5 105,125,507 (GRCm39) missense probably benign
R7685:Abcg3 UTSW 5 105,116,081 (GRCm39) missense probably damaging 1.00
R7819:Abcg3 UTSW 5 105,125,594 (GRCm39) missense probably benign 0.05
R7942:Abcg3 UTSW 5 105,087,027 (GRCm39) missense probably damaging 1.00
R8059:Abcg3 UTSW 5 105,100,948 (GRCm39) critical splice donor site probably null
R9181:Abcg3 UTSW 5 105,121,962 (GRCm39) missense probably benign
R9529:Abcg3 UTSW 5 105,121,973 (GRCm39) missense probably damaging 1.00
R9641:Abcg3 UTSW 5 105,084,483 (GRCm39) missense probably benign
X0022:Abcg3 UTSW 5 105,096,282 (GRCm39) missense probably benign 0.02
X0026:Abcg3 UTSW 5 105,086,055 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTCAGAGGATTGTTTGGAATCAC -3'
(R):5'- GCCTCACATAGATTCAGATGATTG -3'

Sequencing Primer
(F):5'- aaattcctcccccaggaa -3'
(R):5'- GCACATCATGACTACTGTG -3'
Posted On 2019-11-12