Incidental Mutation 'R7728:Lrrk1'
ID595629
Institutional Source Beutler Lab
Gene Symbol Lrrk1
Ensembl Gene ENSMUSG00000015133
Gene Nameleucine-rich repeat kinase 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7728 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location66226912-66388350 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 66262715 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 1699 (V1699A)
Ref Sequence ENSEMBL: ENSMUSP00000015277 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015277] [ENSMUST00000145954]
Predicted Effect probably benign
Transcript: ENSMUST00000015277
AA Change: V1699A

PolyPhen 2 Score 0.004 (Sensitivity: 0.98; Specificity: 0.59)
SMART Domains Protein: ENSMUSP00000015277
Gene: ENSMUSG00000015133
AA Change: V1699A

DomainStartEndE-ValueType
ANK 86 116 9.33e2 SMART
ANK 119 148 1.14e2 SMART
ANK 152 182 8.36e1 SMART
ANK 193 223 2.6e1 SMART
LRR 278 300 2.84e2 SMART
LRR 301 325 7.79e0 SMART
LRR 328 351 3.27e1 SMART
LRR_TYP 379 401 2.53e-2 SMART
LRR 403 427 5.89e1 SMART
LRR 472 493 5.27e1 SMART
LRR 548 569 2.92e2 SMART
LRR 570 594 5.88e0 SMART
Pfam:Arf 625 786 2e-8 PFAM
Pfam:Roc 640 761 3.1e-24 PFAM
Pfam:Ras 640 782 2.2e-7 PFAM
Pfam:COR 844 1046 4.7e-26 PFAM
low complexity region 1109 1119 N/A INTRINSIC
low complexity region 1209 1222 N/A INTRINSIC
Pfam:Pkinase 1243 1521 7.8e-40 PFAM
Pfam:Pkinase_Tyr 1244 1520 9.4e-39 PFAM
low complexity region 1642 1654 N/A INTRINSIC
low complexity region 1839 1846 N/A INTRINSIC
low complexity region 1852 1871 N/A INTRINSIC
low complexity region 1957 1970 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000145954
SMART Domains Protein: ENSMUSP00000114938
Gene: ENSMUSG00000015133

DomainStartEndE-ValueType
low complexity region 24 34 N/A INTRINSIC
low complexity region 124 137 N/A INTRINSIC
Pfam:Pkinase 158 435 6.6e-46 PFAM
Pfam:Pkinase_Tyr 159 435 5.8e-40 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a multi-domain protein that is a leucine-rich repeat kinase and a GDP/GTP binding protein. The encoded protein is thought to play a role in the regulation of bone mass. Mice lacking a similar gene showed severe osteopetrosis, increased bone mineralization and decreased bone resorption. [provided by RefSeq, Jan 2017]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit preweaning lethality. Mice homozygous for another knock-out allele exhibit severe osteopetrosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,256,539 P851S probably damaging Het
2210408I21Rik T A 13: 77,316,477 L931Q possibly damaging Het
Abcg3 T G 5: 104,936,078 I609L probably benign Het
Acly A T 11: 100,516,797 F242L probably damaging Het
Acly C T 11: 100,519,687 G155D probably benign Het
Acsl5 T A 19: 55,287,853 L370* probably null Het
Arhgef17 G A 7: 100,930,068 P558S probably benign Het
Bhlha9 T A 11: 76,673,089 S181T possibly damaging Het
Birc6 A G 17: 74,622,105 T2331A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik T C 5: 76,857,469 V559A unknown Het
Ccdc7b A T 8: 129,072,690 R83W unknown Het
Churc1 T A 12: 76,773,278 N20K probably benign Het
Clec9a T C 6: 129,415,235 S63P possibly damaging Het
Cndp2 T A 18: 84,672,077 M247L probably benign Het
Cpvl C T 6: 53,925,290 S329N probably benign Het
Csmd1 A T 8: 16,231,271 W747R probably damaging Het
Dhx40 A T 11: 86,771,933 D644E probably damaging Het
Disp2 A T 2: 118,791,480 N898Y probably benign Het
Dnah3 G A 7: 119,938,828 H666Y probably damaging Het
Dnajc2 C T 5: 21,770,540 D222N possibly damaging Het
Epha5 A T 5: 84,067,408 M826K possibly damaging Het
Fam13a T C 6: 58,954,299 D432G possibly damaging Het
Fkbp6 A G 5: 135,339,544 L276P probably damaging Het
Gars G T 6: 55,050,386 W155L probably damaging Het
Gm12258 C A 11: 58,859,692 H564Q unknown Het
Gm3127 A G 14: 4,166,059 D79G possibly damaging Het
Gm6614 C A 6: 141,987,710 E470* probably null Het
H2-Q10 T A 17: 35,470,838 I119N probably damaging Het
Harbi1 A G 2: 91,712,281 D29G possibly damaging Het
Hp1bp3 T A 4: 138,225,996 M155K probably damaging Het
Itpr3 T G 17: 27,098,114 M781R probably damaging Het
Kat7 T C 11: 95,300,081 K101E probably benign Het
Kif7 A G 7: 79,710,730 I299T possibly damaging Het
Krt34 A G 11: 100,039,985 probably null Het
Krt81 A G 15: 101,460,206 Y389H probably damaging Het
Lrrc36 A T 8: 105,449,498 E168V probably benign Het
Mdh1b T A 1: 63,715,270 S380C probably benign Het
Mlkl A G 8: 111,333,619 L45P probably damaging Het
Mmp13 T A 9: 7,274,004 D159E probably benign Het
Nanp A G 2: 151,030,915 V31A possibly damaging Het
Nbeal1 T C 1: 60,244,824 S846P probably damaging Het
Neb G A 2: 52,183,299 R5982C probably damaging Het
Nebl G T 2: 17,370,514 F93L Het
Olfr745 G A 14: 50,642,392 G31E probably benign Het
Pcdhb11 A T 18: 37,423,477 N620I probably damaging Het
Pcdhgb2 A G 18: 37,691,207 Y417C probably damaging Het
Pwp2 T C 10: 78,178,561 T402A probably benign Het
Ralgapb T C 2: 158,482,503 probably null Het
Rexo4 G A 2: 26,964,230 A30V probably benign Het
Rrs1 T A 1: 9,546,398 M292K possibly damaging Het
Shroom3 C A 5: 92,683,707 P14Q possibly damaging Het
Slc16a10 T A 10: 40,040,758 I383F probably damaging Het
Slk C A 19: 47,620,816 P736Q probably damaging Het
St6galnac2 T A 11: 116,679,985 H259L probably benign Het
Stambpl1 T G 19: 34,236,321 S317A possibly damaging Het
Syvn1 A G 19: 6,051,205 T429A unknown Het
Tbc1d9 A T 8: 83,259,350 E828V probably damaging Het
Tmtc2 A C 10: 105,271,497 probably null Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Trp53bp1 A C 2: 121,207,899 L1436R probably damaging Het
Ttll5 C T 12: 85,956,632 R1095W probably benign Het
Utp20 A G 10: 88,798,341 F831S probably damaging Het
Vmn2r109 T A 17: 20,552,855 Q501H probably damaging Het
Zcchc17 A G 4: 130,337,019 probably null Het
Zfhx3 A G 8: 108,951,569 M3084V probably benign Het
Zfp81 T C 17: 33,336,817 N12S possibly damaging Het
Other mutations in Lrrk1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01365:Lrrk1 APN 7 66287701 missense probably damaging 1.00
IGL01511:Lrrk1 APN 7 66265450 missense possibly damaging 0.48
IGL02337:Lrrk1 APN 7 66279416 missense possibly damaging 0.92
IGL02636:Lrrk1 APN 7 66308659 critical splice donor site probably null
IGL02679:Lrrk1 APN 7 66274872 missense probably damaging 1.00
IGL02711:Lrrk1 APN 7 66330767 missense probably damaging 1.00
IGL02742:Lrrk1 APN 7 66308691 missense probably benign 0.12
IGL02878:Lrrk1 APN 7 66262563 missense probably benign
IGL03135:Lrrk1 APN 7 66262890 missense probably benign 0.00
IGL03191:Lrrk1 APN 7 66259959 missense probably damaging 0.99
IGL03198:Lrrk1 APN 7 66306894 missense probably damaging 1.00
combustion UTSW 7 66262665 missense possibly damaging 0.94
Heiland UTSW 7 66262733 missense probably damaging 0.96
liebster UTSW 7 66294981 missense probably damaging 1.00
magi UTSW 7 66281648 missense probably damaging 1.00
oxidation UTSW 7 66279372 missense probably benign 0.00
phlogiston UTSW 7 66278520 splice site probably benign
Savior UTSW 7 66262487 missense probably damaging 1.00
wenig UTSW 7 66273001 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0105:Lrrk1 UTSW 7 66292341 missense probably damaging 1.00
R0276:Lrrk1 UTSW 7 66296263 splice site probably benign
R0505:Lrrk1 UTSW 7 66290908 splice site probably null
R0609:Lrrk1 UTSW 7 66266615 splice site probably null
R0650:Lrrk1 UTSW 7 66292336 missense probably damaging 1.00
R0676:Lrrk1 UTSW 7 66294981 missense probably damaging 1.00
R1157:Lrrk1 UTSW 7 66262283 missense probably benign 0.00
R1435:Lrrk1 UTSW 7 66273028 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1468:Lrrk1 UTSW 7 66259974 missense probably damaging 1.00
R1498:Lrrk1 UTSW 7 66302671 nonsense probably null
R1620:Lrrk1 UTSW 7 66381538 missense probably benign 0.00
R1884:Lrrk1 UTSW 7 66262437 missense probably benign
R1891:Lrrk1 UTSW 7 66279300 missense probably damaging 1.00
R1989:Lrrk1 UTSW 7 66281684 missense probably damaging 1.00
R2107:Lrrk1 UTSW 7 66279282 missense probably damaging 1.00
R2140:Lrrk1 UTSW 7 66330750 missense probably damaging 1.00
R2144:Lrrk1 UTSW 7 66296163 missense probably damaging 0.98
R2147:Lrrk1 UTSW 7 66285411 splice site probably null
R3176:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3276:Lrrk1 UTSW 7 66305521 missense possibly damaging 0.69
R3886:Lrrk1 UTSW 7 66292364 missense probably damaging 1.00
R3893:Lrrk1 UTSW 7 66278520 splice site probably benign
R3906:Lrrk1 UTSW 7 66294903 missense possibly damaging 0.84
R4259:Lrrk1 UTSW 7 66330764 missense probably damaging 1.00
R4649:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4653:Lrrk1 UTSW 7 66273053 missense probably benign 0.12
R4672:Lrrk1 UTSW 7 66279372 missense probably benign 0.00
R4693:Lrrk1 UTSW 7 66262487 missense probably damaging 1.00
R4729:Lrrk1 UTSW 7 66262293 missense probably benign
R4737:Lrrk1 UTSW 7 66306873 missense probably benign 0.09
R4795:Lrrk1 UTSW 7 66262665 missense possibly damaging 0.94
R4911:Lrrk1 UTSW 7 66295454 missense probably damaging 0.97
R5002:Lrrk1 UTSW 7 66332363 missense probably damaging 1.00
R5254:Lrrk1 UTSW 7 66307107 missense probably benign 0.00
R5407:Lrrk1 UTSW 7 66270797 missense probably benign 0.20
R5482:Lrrk1 UTSW 7 66330670 missense probably benign
R5600:Lrrk1 UTSW 7 66307215 missense probably benign 0.31
R5615:Lrrk1 UTSW 7 66287615 missense probably damaging 1.00
R6041:Lrrk1 UTSW 7 66262133 missense probably benign
R6211:Lrrk1 UTSW 7 66302710 missense possibly damaging 0.89
R6271:Lrrk1 UTSW 7 66307103 critical splice donor site probably null
R6276:Lrrk1 UTSW 7 66306839 splice site probably null
R6447:Lrrk1 UTSW 7 66302728 missense probably benign 0.19
R6478:Lrrk1 UTSW 7 66262733 missense probably damaging 0.96
R6615:Lrrk1 UTSW 7 66281648 missense probably damaging 1.00
R6745:Lrrk1 UTSW 7 66273001 missense probably damaging 1.00
R6836:Lrrk1 UTSW 7 66342779 missense probably benign 0.05
R6995:Lrrk1 UTSW 7 66292342 missense probably damaging 1.00
R7107:Lrrk1 UTSW 7 66287443 missense possibly damaging 0.94
R7137:Lrrk1 UTSW 7 66285279 missense probably benign 0.06
R7203:Lrrk1 UTSW 7 66270825 missense probably damaging 1.00
R7224:Lrrk1 UTSW 7 66332386 missense probably damaging 0.99
R7239:Lrrk1 UTSW 7 66262155 missense probably benign
R7440:Lrrk1 UTSW 7 66290854 missense probably damaging 1.00
R7515:Lrrk1 UTSW 7 66262562 missense probably benign
R7593:Lrrk1 UTSW 7 66308691 missense probably benign 0.12
R7993:Lrrk1 UTSW 7 66262454 missense probably benign 0.00
R8009:Lrrk1 UTSW 7 66265474 missense possibly damaging 0.82
R8037:Lrrk1 UTSW 7 66285341 missense probably benign
R8101:Lrrk1 UTSW 7 66342782 missense probably benign
R8116:Lrrk1 UTSW 7 66262623 missense possibly damaging 0.95
R8126:Lrrk1 UTSW 7 66292315 missense probably damaging 1.00
R8278:Lrrk1 UTSW 7 66278684 missense probably benign 0.37
RF018:Lrrk1 UTSW 7 66381502 missense possibly damaging 0.83
Predicted Primers PCR Primer
(F):5'- AGCAATTGGCCTTGTCGTCG -3'
(R):5'- AGAATATTGTGTGTCCCTGTCC -3'

Sequencing Primer
(F):5'- TTGTCGTCGAGGCACCAGAC -3'
(R):5'- AGAACTCCTTCCTGGTGCTGG -3'
Posted On2019-11-12