Incidental Mutation 'R7728:Mlkl'
ID595637
Institutional Source Beutler Lab
Gene Symbol Mlkl
Ensembl Gene ENSMUSG00000012519
Gene Namemixed lineage kinase domain-like
Synonyms9130019I15Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.074) question?
Stock #R7728 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location111311797-111338177 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 111333619 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Proline at position 45 (L45P)
Ref Sequence ENSEMBL: ENSMUSP00000055521 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000056157] [ENSMUST00000120432] [ENSMUST00000145862]
PDB Structure Structure of MLKL [X-RAY DIFFRACTION]
Crystal structure of the mouse MLKL kinase-like domain [X-RAY DIFFRACTION]
Crystal structure of the mouse RIP3-MLKL complex [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000056157
AA Change: L45P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000055521
Gene: ENSMUSG00000012519
AA Change: L45P

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 448 2.7e-41 PFAM
Pfam:Pkinase 200 450 2.1e-30 PFAM
Pfam:Kinase-like 270 438 1.6e-7 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000120432
AA Change: L45P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000113718
Gene: ENSMUSG00000012519
AA Change: L45P

DomainStartEndE-ValueType
low complexity region 109 115 N/A INTRINSIC
Pfam:Pkinase_Tyr 195 453 3.3e-42 PFAM
Pfam:Pkinase 196 453 1.4e-33 PFAM
Pfam:Kinase-like 270 438 8.9e-8 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000145862
AA Change: L53P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000114701
Gene: ENSMUSG00000012519
AA Change: L53P

DomainStartEndE-ValueType
PDB:4BTF|A 9 176 1e-114 PDB
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene belongs to the protein kinase superfamily. The encoded protein contains a protein kinase-like domain; however, is thought to lack protein kinase activity. This protein plays a critical role in tumor necrosis factor (TNF)-induced necroptosis, a programmed cell death process, via interaction with receptor-interacting protein 3 (Rip3), which is a key signaling molecule in necroptosis pathway. Knockout of this gene in mice showed that it is essential for necroptosis. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit imapired macrophage and mouse embryonic fibroblast necroptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,256,539 P851S probably damaging Het
2210408I21Rik T A 13: 77,316,477 L931Q possibly damaging Het
Abcg3 T G 5: 104,936,078 I609L probably benign Het
Acly A T 11: 100,516,797 F242L probably damaging Het
Acly C T 11: 100,519,687 G155D probably benign Het
Acsl5 T A 19: 55,287,853 L370* probably null Het
Arhgef17 G A 7: 100,930,068 P558S probably benign Het
Bhlha9 T A 11: 76,673,089 S181T possibly damaging Het
Birc6 A G 17: 74,622,105 T2331A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik T C 5: 76,857,469 V559A unknown Het
Ccdc7b A T 8: 129,072,690 R83W unknown Het
Churc1 T A 12: 76,773,278 N20K probably benign Het
Clec9a T C 6: 129,415,235 S63P possibly damaging Het
Cndp2 T A 18: 84,672,077 M247L probably benign Het
Cpvl C T 6: 53,925,290 S329N probably benign Het
Csmd1 A T 8: 16,231,271 W747R probably damaging Het
Dhx40 A T 11: 86,771,933 D644E probably damaging Het
Disp2 A T 2: 118,791,480 N898Y probably benign Het
Dnah3 G A 7: 119,938,828 H666Y probably damaging Het
Dnajc2 C T 5: 21,770,540 D222N possibly damaging Het
Epha5 A T 5: 84,067,408 M826K possibly damaging Het
Fam13a T C 6: 58,954,299 D432G possibly damaging Het
Fkbp6 A G 5: 135,339,544 L276P probably damaging Het
Gars G T 6: 55,050,386 W155L probably damaging Het
Gm12258 C A 11: 58,859,692 H564Q unknown Het
Gm3127 A G 14: 4,166,059 D79G possibly damaging Het
Gm6614 C A 6: 141,987,710 E470* probably null Het
H2-Q10 T A 17: 35,470,838 I119N probably damaging Het
Harbi1 A G 2: 91,712,281 D29G possibly damaging Het
Hp1bp3 T A 4: 138,225,996 M155K probably damaging Het
Itpr3 T G 17: 27,098,114 M781R probably damaging Het
Kat7 T C 11: 95,300,081 K101E probably benign Het
Kif7 A G 7: 79,710,730 I299T possibly damaging Het
Krt34 A G 11: 100,039,985 probably null Het
Krt81 A G 15: 101,460,206 Y389H probably damaging Het
Lrrc36 A T 8: 105,449,498 E168V probably benign Het
Lrrk1 A G 7: 66,262,715 V1699A probably benign Het
Mdh1b T A 1: 63,715,270 S380C probably benign Het
Mmp13 T A 9: 7,274,004 D159E probably benign Het
Nanp A G 2: 151,030,915 V31A possibly damaging Het
Nbeal1 T C 1: 60,244,824 S846P probably damaging Het
Neb G A 2: 52,183,299 R5982C probably damaging Het
Nebl G T 2: 17,370,514 F93L Het
Olfr745 G A 14: 50,642,392 G31E probably benign Het
Pcdhb11 A T 18: 37,423,477 N620I probably damaging Het
Pcdhgb2 A G 18: 37,691,207 Y417C probably damaging Het
Pwp2 T C 10: 78,178,561 T402A probably benign Het
Ralgapb T C 2: 158,482,503 probably null Het
Rexo4 G A 2: 26,964,230 A30V probably benign Het
Rrs1 T A 1: 9,546,398 M292K possibly damaging Het
Shroom3 C A 5: 92,683,707 P14Q possibly damaging Het
Slc16a10 T A 10: 40,040,758 I383F probably damaging Het
Slk C A 19: 47,620,816 P736Q probably damaging Het
St6galnac2 T A 11: 116,679,985 H259L probably benign Het
Stambpl1 T G 19: 34,236,321 S317A possibly damaging Het
Syvn1 A G 19: 6,051,205 T429A unknown Het
Tbc1d9 A T 8: 83,259,350 E828V probably damaging Het
Tmtc2 A C 10: 105,271,497 probably null Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Trp53bp1 A C 2: 121,207,899 L1436R probably damaging Het
Ttll5 C T 12: 85,956,632 R1095W probably benign Het
Utp20 A G 10: 88,798,341 F831S probably damaging Het
Vmn2r109 T A 17: 20,552,855 Q501H probably damaging Het
Zcchc17 A G 4: 130,337,019 probably null Het
Zfhx3 A G 8: 108,951,569 M3084V probably benign Het
Zfp81 T C 17: 33,336,817 N12S possibly damaging Het
Other mutations in Mlkl
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:Mlkl APN 8 111319428 nonsense probably null
IGL01376:Mlkl APN 8 111319747 missense probably damaging 1.00
IGL02801:Mlkl APN 8 111316432 missense probably benign 0.18
IGL02965:Mlkl APN 8 111331837 missense probably benign 0.31
IGL03121:Mlkl APN 8 111314980 missense probably damaging 1.00
Ghoulish UTSW 8 111322748 missense probably damaging 1.00
mecro UTSW 8 111319716 critical splice donor site probably null
necro UTSW 8 111312100 intron probably benign
secro UTSW 8 111315567 intron probably benign
R0133:Mlkl UTSW 8 111327948 missense probably damaging 1.00
R0230:Mlkl UTSW 8 111315062 missense probably benign 0.07
R0387:Mlkl UTSW 8 111333350 missense probably damaging 1.00
R0497:Mlkl UTSW 8 111327873 missense probably damaging 1.00
R0735:Mlkl UTSW 8 111327801 unclassified probably benign
R1733:Mlkl UTSW 8 111322748 missense probably damaging 1.00
R1761:Mlkl UTSW 8 111333723 missense possibly damaging 0.81
R1911:Mlkl UTSW 8 111312100 intron probably benign
R2057:Mlkl UTSW 8 111333610 missense probably benign 0.07
R2921:Mlkl UTSW 8 111316447 missense probably benign 0.02
R3745:Mlkl UTSW 8 111315567 intron probably benign
R4760:Mlkl UTSW 8 111319716 critical splice donor site probably null
R5377:Mlkl UTSW 8 111327937 missense probably benign 0.23
R7052:Mlkl UTSW 8 111319442 missense possibly damaging 0.65
R7155:Mlkl UTSW 8 111319403 missense probably damaging 1.00
R7459:Mlkl UTSW 8 111333530 missense probably benign 0.36
R8036:Mlkl UTSW 8 111333454 missense probably damaging 1.00
R8064:Mlkl UTSW 8 111312068 missense probably benign 0.38
Predicted Primers PCR Primer
(F):5'- ATGATAAACCTGAAGCAGCAGC -3'
(R):5'- AGGGGATTGTGGTATTTCAACC -3'

Sequencing Primer
(F):5'- AGCTCCTCCCAGACGTC -3'
(R):5'- GGTATTTCAACCAGTCTATGCATC -3'
Posted On2019-11-12