Incidental Mutation 'R7728:Mmp13'
ID595639
Institutional Source Beutler Lab
Gene Symbol Mmp13
Ensembl Gene ENSMUSG00000050578
Gene Namematrix metallopeptidase 13
SynonymsMMP-13, interstitial collagenase, Clg, Mmp1, Collagenase-3, collagenase-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.144) question?
Stock #R7728 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location7272514-7283331 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 7274004 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 159 (D159E)
Ref Sequence ENSEMBL: ENSMUSP00000015394 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000015394]
PDB Structure STRUCTURE OF RECOMBINANT MOUSE COLLAGENASE-3 (MMP-13) [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000015394
AA Change: D159E

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000015394
Gene: ENSMUSG00000050578
AA Change: D159E

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:PG_binding_1 33 92 5.3e-13 PFAM
ZnMc 110 269 3.76e-59 SMART
HX 291 333 9.62e-8 SMART
HX 335 378 9.91e-10 SMART
HX 383 430 2.52e-11 SMART
HX 432 472 1.81e-3 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: This gene encodes a member of the matrix metalloproteinase family that plays a role in wound healing, skeletal development and bone remodeling. The encoded protein is activated by the removal of an N-terminal activation peptide to generate a zinc-dependent endopeptidase enzyme that can cleave various native collagens, including types I - IV, X and XIV. Mice lacking the encoded protein display profound defects in growth plate cartilage as well as a delay in the endochondral bone development. Lack of the encoded protein also impairs the wound healing process due to reduced keratinocyte migration and vascular density at the wound site. This gene is located in a cluster of other matrix metalloproteinase genes on chromosome 9. [provided by RefSeq, Jun 2015]
PHENOTYPE: Homozygous null mice display increased width of hypertrophic chondrocyte zone and increased trabecular bone. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,256,539 P851S probably damaging Het
2210408I21Rik T A 13: 77,316,477 L931Q possibly damaging Het
Abcg3 T G 5: 104,936,078 I609L probably benign Het
Acly A T 11: 100,516,797 F242L probably damaging Het
Acly C T 11: 100,519,687 G155D probably benign Het
Acsl5 T A 19: 55,287,853 L370* probably null Het
Arhgef17 G A 7: 100,930,068 P558S probably benign Het
Bhlha9 T A 11: 76,673,089 S181T possibly damaging Het
Birc6 A G 17: 74,622,105 T2331A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik T C 5: 76,857,469 V559A unknown Het
Ccdc7b A T 8: 129,072,690 R83W unknown Het
Churc1 T A 12: 76,773,278 N20K probably benign Het
Clec9a T C 6: 129,415,235 S63P possibly damaging Het
Cndp2 T A 18: 84,672,077 M247L probably benign Het
Cpvl C T 6: 53,925,290 S329N probably benign Het
Csmd1 A T 8: 16,231,271 W747R probably damaging Het
Dhx40 A T 11: 86,771,933 D644E probably damaging Het
Disp2 A T 2: 118,791,480 N898Y probably benign Het
Dnah3 G A 7: 119,938,828 H666Y probably damaging Het
Dnajc2 C T 5: 21,770,540 D222N possibly damaging Het
Epha5 A T 5: 84,067,408 M826K possibly damaging Het
Fam13a T C 6: 58,954,299 D432G possibly damaging Het
Fkbp6 A G 5: 135,339,544 L276P probably damaging Het
Gars G T 6: 55,050,386 W155L probably damaging Het
Gm12258 C A 11: 58,859,692 H564Q unknown Het
Gm3127 A G 14: 4,166,059 D79G possibly damaging Het
Gm6614 C A 6: 141,987,710 E470* probably null Het
H2-Q10 T A 17: 35,470,838 I119N probably damaging Het
Harbi1 A G 2: 91,712,281 D29G possibly damaging Het
Hp1bp3 T A 4: 138,225,996 M155K probably damaging Het
Itpr3 T G 17: 27,098,114 M781R probably damaging Het
Kat7 T C 11: 95,300,081 K101E probably benign Het
Kif7 A G 7: 79,710,730 I299T possibly damaging Het
Krt34 A G 11: 100,039,985 probably null Het
Krt81 A G 15: 101,460,206 Y389H probably damaging Het
Lrrc36 A T 8: 105,449,498 E168V probably benign Het
Lrrk1 A G 7: 66,262,715 V1699A probably benign Het
Mdh1b T A 1: 63,715,270 S380C probably benign Het
Mlkl A G 8: 111,333,619 L45P probably damaging Het
Nanp A G 2: 151,030,915 V31A possibly damaging Het
Nbeal1 T C 1: 60,244,824 S846P probably damaging Het
Neb G A 2: 52,183,299 R5982C probably damaging Het
Nebl G T 2: 17,370,514 F93L Het
Olfr745 G A 14: 50,642,392 G31E probably benign Het
Pcdhb11 A T 18: 37,423,477 N620I probably damaging Het
Pcdhgb2 A G 18: 37,691,207 Y417C probably damaging Het
Pwp2 T C 10: 78,178,561 T402A probably benign Het
Ralgapb T C 2: 158,482,503 probably null Het
Rexo4 G A 2: 26,964,230 A30V probably benign Het
Rrs1 T A 1: 9,546,398 M292K possibly damaging Het
Shroom3 C A 5: 92,683,707 P14Q possibly damaging Het
Slc16a10 T A 10: 40,040,758 I383F probably damaging Het
Slk C A 19: 47,620,816 P736Q probably damaging Het
St6galnac2 T A 11: 116,679,985 H259L probably benign Het
Stambpl1 T G 19: 34,236,321 S317A possibly damaging Het
Syvn1 A G 19: 6,051,205 T429A unknown Het
Tbc1d9 A T 8: 83,259,350 E828V probably damaging Het
Tmtc2 A C 10: 105,271,497 probably null Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Trp53bp1 A C 2: 121,207,899 L1436R probably damaging Het
Ttll5 C T 12: 85,956,632 R1095W probably benign Het
Utp20 A G 10: 88,798,341 F831S probably damaging Het
Vmn2r109 T A 17: 20,552,855 Q501H probably damaging Het
Zcchc17 A G 4: 130,337,019 probably null Het
Zfhx3 A G 8: 108,951,569 M3084V probably benign Het
Zfp81 T C 17: 33,336,817 N12S possibly damaging Het
Other mutations in Mmp13
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01976:Mmp13 APN 9 7278974 splice site probably benign
IGL02027:Mmp13 APN 9 7272955 missense probably damaging 1.00
IGL02320:Mmp13 APN 9 7278941 missense probably benign 0.00
R0143:Mmp13 UTSW 9 7276558 missense probably damaging 1.00
R0417:Mmp13 UTSW 9 7276602 missense probably benign
R0505:Mmp13 UTSW 9 7272929 missense probably damaging 1.00
R0624:Mmp13 UTSW 9 7280221 missense possibly damaging 0.69
R0632:Mmp13 UTSW 9 7274032 missense probably damaging 1.00
R0632:Mmp13 UTSW 9 7282077 missense possibly damaging 0.74
R1102:Mmp13 UTSW 9 7272952 missense possibly damaging 0.55
R1387:Mmp13 UTSW 9 7282033 missense possibly damaging 0.60
R1478:Mmp13 UTSW 9 7272892 missense probably damaging 1.00
R1669:Mmp13 UTSW 9 7277926 missense probably benign 0.01
R4647:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4648:Mmp13 UTSW 9 7274233 missense probably damaging 1.00
R4668:Mmp13 UTSW 9 7272580 missense possibly damaging 0.54
R4827:Mmp13 UTSW 9 7278880 missense possibly damaging 0.68
R4898:Mmp13 UTSW 9 7272953 missense probably benign 0.10
R5780:Mmp13 UTSW 9 7278952 missense possibly damaging 0.76
R5946:Mmp13 UTSW 9 7276580 missense probably damaging 1.00
R5996:Mmp13 UTSW 9 7274269 missense probably damaging 1.00
R6102:Mmp13 UTSW 9 7276688 missense probably benign 0.07
R6693:Mmp13 UTSW 9 7280245 missense probably benign 0.00
R6789:Mmp13 UTSW 9 7272781 missense probably benign 0.00
R7310:Mmp13 UTSW 9 7280880 missense possibly damaging 0.60
R8041:Mmp13 UTSW 9 7280865 missense probably benign 0.13
R8314:Mmp13 UTSW 9 7272931 missense probably damaging 1.00
R8324:Mmp13 UTSW 9 7276636 missense possibly damaging 0.75
R8684:Mmp13 UTSW 9 7282089 missense possibly damaging 0.51
R8755:Mmp13 UTSW 9 7277996 missense possibly damaging 0.51
T0722:Mmp13 UTSW 9 7280857 missense possibly damaging 0.67
Z1177:Mmp13 UTSW 9 7277953 missense probably damaging 1.00
Z1177:Mmp13 UTSW 9 7280200 missense possibly damaging 0.89
Predicted Primers PCR Primer
(F):5'- TGCCAGATTTTAGCTGCCAAC -3'
(R):5'- AGACAGCAAGAGTTAGAGTCCC -3'

Sequencing Primer
(F):5'- GCCCTATGAATGATTGTGAGCCAC -3'
(R):5'- GAGTCCCATTATATATACTGTGCCTG -3'
Posted On2019-11-12