Incidental Mutation 'R7728:Slc16a10'
ID595642
Institutional Source Beutler Lab
Gene Symbol Slc16a10
Ensembl Gene ENSMUSG00000019838
Gene Namesolute carrier family 16 (monocarboxylic acid transporters), member 10
SynonymsMct10, 2610103N14Rik, TAT1, PRO0813
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R7728 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location40033532-40142258 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40040758 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 383 (I383F)
Ref Sequence ENSEMBL: ENSMUSP00000090227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000092566]
Predicted Effect probably damaging
Transcript: ENSMUST00000092566
AA Change: I383F

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000090227
Gene: ENSMUSG00000019838
AA Change: I383F

DomainStartEndE-ValueType
Pfam:MFS_1 66 320 1.1e-13 PFAM
Pfam:MFS_4 269 464 4.3e-11 PFAM
Pfam:MFS_1 291 507 4.3e-18 PFAM
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] SLC16A10 is a member of a family of plasma membrane amino acid transporters that mediate the Na(+)-independent transport of aromatic amino acids across the plasma membrane.[supplied by OMIM, Apr 2004]
PHENOTYPE: Mice homozygous for an ENU-induced null allele exhibit altered amino acid homeostasis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,256,539 P851S probably damaging Het
2210408I21Rik T A 13: 77,316,477 L931Q possibly damaging Het
Abcg3 T G 5: 104,936,078 I609L probably benign Het
Acly A T 11: 100,516,797 F242L probably damaging Het
Acly C T 11: 100,519,687 G155D probably benign Het
Acsl5 T A 19: 55,287,853 L370* probably null Het
Arhgef17 G A 7: 100,930,068 P558S probably benign Het
Bhlha9 T A 11: 76,673,089 S181T possibly damaging Het
Birc6 A G 17: 74,622,105 T2331A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik T C 5: 76,857,469 V559A unknown Het
Ccdc7b A T 8: 129,072,690 R83W unknown Het
Churc1 T A 12: 76,773,278 N20K probably benign Het
Clec9a T C 6: 129,415,235 S63P possibly damaging Het
Cndp2 T A 18: 84,672,077 M247L probably benign Het
Cpvl C T 6: 53,925,290 S329N probably benign Het
Csmd1 A T 8: 16,231,271 W747R probably damaging Het
Dhx40 A T 11: 86,771,933 D644E probably damaging Het
Disp2 A T 2: 118,791,480 N898Y probably benign Het
Dnah3 G A 7: 119,938,828 H666Y probably damaging Het
Dnajc2 C T 5: 21,770,540 D222N possibly damaging Het
Epha5 A T 5: 84,067,408 M826K possibly damaging Het
Fam13a T C 6: 58,954,299 D432G possibly damaging Het
Fkbp6 A G 5: 135,339,544 L276P probably damaging Het
Gars G T 6: 55,050,386 W155L probably damaging Het
Gm12258 C A 11: 58,859,692 H564Q unknown Het
Gm3127 A G 14: 4,166,059 D79G possibly damaging Het
Gm6614 C A 6: 141,987,710 E470* probably null Het
H2-Q10 T A 17: 35,470,838 I119N probably damaging Het
Harbi1 A G 2: 91,712,281 D29G possibly damaging Het
Hp1bp3 T A 4: 138,225,996 M155K probably damaging Het
Itpr3 T G 17: 27,098,114 M781R probably damaging Het
Kat7 T C 11: 95,300,081 K101E probably benign Het
Kif7 A G 7: 79,710,730 I299T possibly damaging Het
Krt34 A G 11: 100,039,985 probably null Het
Krt81 A G 15: 101,460,206 Y389H probably damaging Het
Lrrc36 A T 8: 105,449,498 E168V probably benign Het
Lrrk1 A G 7: 66,262,715 V1699A probably benign Het
Mdh1b T A 1: 63,715,270 S380C probably benign Het
Mlkl A G 8: 111,333,619 L45P probably damaging Het
Mmp13 T A 9: 7,274,004 D159E probably benign Het
Nanp A G 2: 151,030,915 V31A possibly damaging Het
Nbeal1 T C 1: 60,244,824 S846P probably damaging Het
Neb G A 2: 52,183,299 R5982C probably damaging Het
Nebl G T 2: 17,370,514 F93L Het
Olfr745 G A 14: 50,642,392 G31E probably benign Het
Pcdhb11 A T 18: 37,423,477 N620I probably damaging Het
Pcdhgb2 A G 18: 37,691,207 Y417C probably damaging Het
Pwp2 T C 10: 78,178,561 T402A probably benign Het
Ralgapb T C 2: 158,482,503 probably null Het
Rexo4 G A 2: 26,964,230 A30V probably benign Het
Rrs1 T A 1: 9,546,398 M292K possibly damaging Het
Shroom3 C A 5: 92,683,707 P14Q possibly damaging Het
Slk C A 19: 47,620,816 P736Q probably damaging Het
St6galnac2 T A 11: 116,679,985 H259L probably benign Het
Stambpl1 T G 19: 34,236,321 S317A possibly damaging Het
Syvn1 A G 19: 6,051,205 T429A unknown Het
Tbc1d9 A T 8: 83,259,350 E828V probably damaging Het
Tmtc2 A C 10: 105,271,497 probably null Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Trp53bp1 A C 2: 121,207,899 L1436R probably damaging Het
Ttll5 C T 12: 85,956,632 R1095W probably benign Het
Utp20 A G 10: 88,798,341 F831S probably damaging Het
Vmn2r109 T A 17: 20,552,855 Q501H probably damaging Het
Zcchc17 A G 4: 130,337,019 probably null Het
Zfhx3 A G 8: 108,951,569 M3084V probably benign Het
Zfp81 T C 17: 33,336,817 N12S possibly damaging Het
Other mutations in Slc16a10
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01140:Slc16a10 APN 10 40076925 missense probably damaging 1.00
R0030:Slc16a10 UTSW 10 40076823 missense probably benign 0.04
R0196:Slc16a10 UTSW 10 40056615 missense probably benign 0.01
R0200:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0418:Slc16a10 UTSW 10 40040631 nonsense probably null
R0463:Slc16a10 UTSW 10 40040616 missense probably benign 0.37
R0599:Slc16a10 UTSW 10 40141918 missense probably benign
R1162:Slc16a10 UTSW 10 40076553 missense probably benign 0.00
R1554:Slc16a10 UTSW 10 40076800 missense probably benign 0.00
R1901:Slc16a10 UTSW 10 40056606 nonsense probably null
R3622:Slc16a10 UTSW 10 40141894 missense probably benign
R3624:Slc16a10 UTSW 10 40141894 missense probably benign
R3717:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3719:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3729:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3730:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3731:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3801:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3803:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R3804:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4037:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4038:Slc16a10 UTSW 10 40056624 missense possibly damaging 0.94
R4254:Slc16a10 UTSW 10 40077001 missense probably damaging 1.00
R4980:Slc16a10 UTSW 10 40080805 missense probably damaging 1.00
R5498:Slc16a10 UTSW 10 40037327 missense probably damaging 0.99
R5542:Slc16a10 UTSW 10 40076788 missense probably benign 0.03
R6541:Slc16a10 UTSW 10 40037272 missense probably benign 0.00
R6555:Slc16a10 UTSW 10 40080778 missense probably benign 0.41
R6998:Slc16a10 UTSW 10 40056503 missense possibly damaging 0.63
R7171:Slc16a10 UTSW 10 40037259 missense probably benign 0.03
R7354:Slc16a10 UTSW 10 40076955 missense probably damaging 1.00
R7414:Slc16a10 UTSW 10 40141996 missense probably benign 0.02
R7792:Slc16a10 UTSW 10 40037415 splice site probably null
R8366:Slc16a10 UTSW 10 40076871 missense probably benign 0.01
Z1177:Slc16a10 UTSW 10 40076971 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ACTCGCAGACTGTTCCCAAC -3'
(R):5'- AAATGGTTATGCTCTTGCTCCC -3'

Sequencing Primer
(F):5'- CCTAGGTCTAGAATAGCCAGGGTTAC -3'
(R):5'- GCTCTTGCTCCCTAATGAAAATAG -3'
Posted On2019-11-12