Incidental Mutation 'R7728:Vmn2r109'
ID 595660
Institutional Source Beutler Lab
Gene Symbol Vmn2r109
Ensembl Gene ENSMUSG00000090572
Gene Name vomeronasal 2, receptor 109
Synonyms EG627814
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock # R7728 (G1)
Quality Score 210.009
Status Validated
Chromosome 17
Chromosomal Location 20540517-20564756 bp(-) (GRCm38)
Type of Mutation missense
DNA Base Change (assembly) T to A at 20552855 bp (GRCm38)
Zygosity Heterozygous
Amino Acid Change Glutamine to Histidine at position 501 (Q501H)
Ref Sequence ENSEMBL: ENSMUSP00000132641 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000167093]
AlphaFold K7N747
Predicted Effect probably damaging
Transcript: ENSMUST00000167093
AA Change: Q501H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000132641
Gene: ENSMUSG00000090572
AA Change: Q501H

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 83 467 1.4e-35 PFAM
Pfam:NCD3G 510 563 3.1e-21 PFAM
Pfam:7tm_3 596 831 7.4e-52 PFAM
Meta Mutation Damage Score 0.6329 question?
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 99.0%
Validation Efficiency 100% (66/66)
Allele List at MGI
Other mutations in this stock
Total: 67 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700017B05Rik G A 9: 57,256,539 P851S probably damaging Het
2210408I21Rik T A 13: 77,316,477 L931Q possibly damaging Het
Abcg3 T G 5: 104,936,078 I609L probably benign Het
Acly A T 11: 100,516,797 F242L probably damaging Het
Acly C T 11: 100,519,687 G155D probably benign Het
Acsl5 T A 19: 55,287,853 L370* probably null Het
Arhgef17 G A 7: 100,930,068 P558S probably benign Het
Bhlha9 T A 11: 76,673,089 S181T possibly damaging Het
Birc6 A G 17: 74,622,105 T2331A probably benign Het
C1ra G A 6: 124,517,725 E316K probably benign Het
C530008M17Rik T C 5: 76,857,469 V559A unknown Het
Ccdc7b A T 8: 129,072,690 R83W unknown Het
Churc1 T A 12: 76,773,278 N20K probably benign Het
Clec9a T C 6: 129,415,235 S63P possibly damaging Het
Cndp2 T A 18: 84,672,077 M247L probably benign Het
Cpvl C T 6: 53,925,290 S329N probably benign Het
Csmd1 A T 8: 16,231,271 W747R probably damaging Het
Dhx40 A T 11: 86,771,933 D644E probably damaging Het
Disp2 A T 2: 118,791,480 N898Y probably benign Het
Dnah3 G A 7: 119,938,828 H666Y probably damaging Het
Dnajc2 C T 5: 21,770,540 D222N possibly damaging Het
Epha5 A T 5: 84,067,408 M826K possibly damaging Het
Fam13a T C 6: 58,954,299 D432G possibly damaging Het
Fkbp6 A G 5: 135,339,544 L276P probably damaging Het
Gars G T 6: 55,050,386 W155L probably damaging Het
Gm12258 C A 11: 58,859,692 H564Q unknown Het
Gm3127 A G 14: 4,166,059 D79G possibly damaging Het
Gm6614 C A 6: 141,987,710 E470* probably null Het
H2-Q10 T A 17: 35,470,838 I119N probably damaging Het
Harbi1 A G 2: 91,712,281 D29G possibly damaging Het
Hp1bp3 T A 4: 138,225,996 M155K probably damaging Het
Itpr3 T G 17: 27,098,114 M781R probably damaging Het
Kat7 T C 11: 95,300,081 K101E probably benign Het
Kif7 A G 7: 79,710,730 I299T possibly damaging Het
Krt34 A G 11: 100,039,985 probably null Het
Krt81 A G 15: 101,460,206 Y389H probably damaging Het
Lrrc36 A T 8: 105,449,498 E168V probably benign Het
Lrrk1 A G 7: 66,262,715 V1699A probably benign Het
Mdh1b T A 1: 63,715,270 S380C probably benign Het
Mlkl A G 8: 111,333,619 L45P probably damaging Het
Mmp13 T A 9: 7,274,004 D159E probably benign Het
Nanp A G 2: 151,030,915 V31A possibly damaging Het
Nbeal1 T C 1: 60,244,824 S846P probably damaging Het
Neb G A 2: 52,183,299 R5982C probably damaging Het
Nebl G T 2: 17,370,514 F93L Het
Olfr745 G A 14: 50,642,392 G31E probably benign Het
Pcdhb11 A T 18: 37,423,477 N620I probably damaging Het
Pcdhgb2 A G 18: 37,691,207 Y417C probably damaging Het
Pwp2 T C 10: 78,178,561 T402A probably benign Het
Ralgapb T C 2: 158,482,503 probably null Het
Rexo4 G A 2: 26,964,230 A30V probably benign Het
Rrs1 T A 1: 9,546,398 M292K possibly damaging Het
Shroom3 C A 5: 92,683,707 P14Q possibly damaging Het
Slc16a10 T A 10: 40,040,758 I383F probably damaging Het
Slk C A 19: 47,620,816 P736Q probably damaging Het
St6galnac2 T A 11: 116,679,985 H259L probably benign Het
Stambpl1 T G 19: 34,236,321 S317A possibly damaging Het
Syvn1 A G 19: 6,051,205 T429A unknown Het
Tbc1d9 A T 8: 83,259,350 E828V probably damaging Het
Tmtc2 A C 10: 105,271,497 probably null Het
Trmt11 A G 10: 30,587,501 I206T possibly damaging Het
Trp53bp1 A C 2: 121,207,899 L1436R probably damaging Het
Ttll5 C T 12: 85,956,632 R1095W probably benign Het
Utp20 A G 10: 88,798,341 F831S probably damaging Het
Zcchc17 A G 4: 130,337,019 probably null Het
Zfhx3 A G 8: 108,951,569 M3084V probably benign Het
Zfp81 T C 17: 33,336,817 N12S possibly damaging Het
Other mutations in Vmn2r109
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01313:Vmn2r109 APN 17 20550157 missense probably damaging 1.00
IGL01383:Vmn2r109 APN 17 20541121 missense possibly damaging 0.89
IGL01469:Vmn2r109 APN 17 20541409 missense probably damaging 1.00
IGL01762:Vmn2r109 APN 17 20554392 missense probably benign
IGL01864:Vmn2r109 APN 17 20541134 missense probably benign 0.28
IGL02028:Vmn2r109 APN 17 20541080 missense probably benign 0.28
IGL02074:Vmn2r109 APN 17 20554341 missense probably benign 0.05
IGL02162:Vmn2r109 APN 17 20554160 missense probably benign 0.01
IGL02474:Vmn2r109 APN 17 20540888 missense probably benign
IGL02490:Vmn2r109 APN 17 20540984 missense possibly damaging 0.78
IGL02604:Vmn2r109 APN 17 20540701 missense probably damaging 1.00
IGL02669:Vmn2r109 APN 17 20554256 missense possibly damaging 0.64
IGL02705:Vmn2r109 APN 17 20553800 missense probably benign
IGL02745:Vmn2r109 APN 17 20541250 missense probably damaging 0.99
PIT4142001:Vmn2r109 UTSW 17 20554577 critical splice acceptor site probably null
R0389:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R0470:Vmn2r109 UTSW 17 20552886 missense probably benign 0.06
R0570:Vmn2r109 UTSW 17 20540675 missense probably damaging 0.99
R0855:Vmn2r109 UTSW 17 20541408 nonsense probably null
R0882:Vmn2r109 UTSW 17 20554580 splice site probably benign
R1241:Vmn2r109 UTSW 17 20555241 missense possibly damaging 0.86
R1587:Vmn2r109 UTSW 17 20540740 missense probably damaging 1.00
R1931:Vmn2r109 UTSW 17 20553810 nonsense probably null
R1957:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R1962:Vmn2r109 UTSW 17 20553923 missense probably damaging 0.99
R2020:Vmn2r109 UTSW 17 20541186 nonsense probably null
R2073:Vmn2r109 UTSW 17 20564712 missense probably benign 0.00
R2436:Vmn2r109 UTSW 17 20554536 missense probably damaging 0.99
R3123:Vmn2r109 UTSW 17 20540986 missense probably damaging 1.00
R3839:Vmn2r109 UTSW 17 20554442 missense probably damaging 1.00
R4019:Vmn2r109 UTSW 17 20553812 missense probably benign
R4428:Vmn2r109 UTSW 17 20553024 missense probably benign
R4584:Vmn2r109 UTSW 17 20554558 nonsense probably null
R4652:Vmn2r109 UTSW 17 20541394 missense probably damaging 1.00
R4708:Vmn2r109 UTSW 17 20541343 missense probably damaging 0.97
R4823:Vmn2r109 UTSW 17 20553891 missense probably damaging 1.00
R4831:Vmn2r109 UTSW 17 20541232 missense probably benign 0.01
R4907:Vmn2r109 UTSW 17 20550086 missense probably damaging 1.00
R5011:Vmn2r109 UTSW 17 20555189 missense probably damaging 1.00
R5296:Vmn2r109 UTSW 17 20554341 missense possibly damaging 0.90
R5600:Vmn2r109 UTSW 17 20540927 missense probably damaging 1.00
R5602:Vmn2r109 UTSW 17 20540671 missense possibly damaging 0.94
R5652:Vmn2r109 UTSW 17 20540519 makesense probably null
R5702:Vmn2r109 UTSW 17 20554145 missense probably benign 0.42
R5706:Vmn2r109 UTSW 17 20554305 missense probably benign 0.16
R5714:Vmn2r109 UTSW 17 20552859 missense probably damaging 1.00
R5832:Vmn2r109 UTSW 17 20541056 missense probably benign 0.10
R6008:Vmn2r109 UTSW 17 20540719 missense probably damaging 1.00
R6334:Vmn2r109 UTSW 17 20541178 missense probably benign 0.18
R6377:Vmn2r109 UTSW 17 20564534 critical splice donor site probably null
R6738:Vmn2r109 UTSW 17 20554523 missense possibly damaging 0.52
R6857:Vmn2r109 UTSW 17 20540670 missense probably benign 0.45
R6953:Vmn2r109 UTSW 17 20540711 missense possibly damaging 0.95
R7108:Vmn2r109 UTSW 17 20564744 missense probably benign 0.03
R7229:Vmn2r109 UTSW 17 20540963 missense possibly damaging 0.80
R7238:Vmn2r109 UTSW 17 20541074 missense probably damaging 1.00
R7244:Vmn2r109 UTSW 17 20540683 missense possibly damaging 0.70
R7292:Vmn2r109 UTSW 17 20541438 missense probably benign 0.05
R7354:Vmn2r109 UTSW 17 20540781 missense probably damaging 1.00
R7357:Vmn2r109 UTSW 17 20541274 missense probably damaging 1.00
R7522:Vmn2r109 UTSW 17 20554403 missense probably benign 0.11
R7596:Vmn2r109 UTSW 17 20540680 missense probably damaging 0.98
R7859:Vmn2r109 UTSW 17 20541174 missense probably damaging 1.00
R7871:Vmn2r109 UTSW 17 20540520 missense probably benign 0.08
R8113:Vmn2r109 UTSW 17 20554467 missense probably benign 0.01
R8153:Vmn2r109 UTSW 17 20564707 missense probably benign 0.11
R8977:Vmn2r109 UTSW 17 20554269 missense possibly damaging 0.96
Z1176:Vmn2r109 UTSW 17 20552994 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GATTACTGCAAGCCTTATTTCACAC -3'
(R):5'- TTCCTGAAGGACATTGATGAGAGAAAC -3'

Sequencing Primer
(F):5'- CTTCCTCTAATCTGAATGAAGGAAC -3'
(R):5'- ACAATATGAATTCAGGTGGGAGAC -3'
Posted On 2019-11-12