Incidental Mutation 'R0242:Cdcp1'
ID 59567
Institutional Source Beutler Lab
Gene Symbol Cdcp1
Ensembl Gene ENSMUSG00000035498
Gene Name CUB domain containing protein 1
Synonyms E030027H19Rik, 9030022E12Rik
MMRRC Submission 038480-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R0242 (G1)
Quality Score 225
Status Validated
Chromosome 9
Chromosomal Location 122999889-123045103 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to T at 123009237 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Phenylalanine to Leucine at position 480 (F480L)
Ref Sequence ENSEMBL: ENSMUSP00000042057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039229]
AlphaFold Q5U462
Predicted Effect probably benign
Transcript: ENSMUST00000039229
AA Change: F480L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000042057
Gene: ENSMUSG00000035498
AA Change: F480L

signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 56 267 1.33e-11 PROSPERO
internal_repeat_1 374 591 1.33e-11 PROSPERO
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148158
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which contains three extracellular CUB domains and acts as a substrate for Src family kinases. The protein plays a role in the tyrosine phosphorylation-dependent regulation of cellular events that are involved in tumor invasion and metastasis. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,601,676 (GRCm39) D230G probably benign Het
Abhd13 A G 8: 10,037,561 (GRCm39) I53V probably benign Het
Adgrl2 A C 3: 148,544,821 (GRCm39) probably null Het
Aldh16a1 G A 7: 44,794,088 (GRCm39) A596V probably damaging Het
Aldh3b2 T A 19: 4,029,414 (GRCm39) Y262* probably null Het
Ambn A G 5: 88,615,831 (GRCm39) Q420R possibly damaging Het
Ankib1 A C 5: 3,750,344 (GRCm39) probably benign Het
Arhgap9 C A 10: 127,165,407 (GRCm39) H430Q probably benign Het
Arhgef25 C T 10: 127,019,933 (GRCm39) G435E probably damaging Het
Armc12 A T 17: 28,751,366 (GRCm39) D120V possibly damaging Het
Asxl3 G A 18: 22,649,738 (GRCm39) E576K possibly damaging Het
Bcdin3d T C 15: 99,368,776 (GRCm39) E141G probably benign Het
Bmpr1b G A 3: 141,546,437 (GRCm39) T483M probably damaging Het
Caprin2 C T 6: 148,744,452 (GRCm39) S991N probably damaging Het
Cd96 T C 16: 45,892,129 (GRCm39) I286M possibly damaging Het
Celf5 T C 10: 81,300,243 (GRCm39) T258A probably benign Het
Cgnl1 A G 9: 71,628,939 (GRCm39) V577A probably damaging Het
Clca3b A G 3: 144,547,226 (GRCm39) S304P probably benign Het
Cmya5 A T 13: 93,232,108 (GRCm39) H993Q probably benign Het
Cnbp A T 6: 87,822,746 (GRCm39) C6S probably damaging Het
Col14a1 C T 15: 55,360,907 (GRCm39) R1605W probably damaging Het
Cops7a T C 6: 124,941,817 (GRCm39) N11S probably benign Het
Coro7 T C 16: 4,448,042 (GRCm39) probably benign Het
Cpvl T C 6: 53,909,485 (GRCm39) H217R possibly damaging Het
Cuedc1 T C 11: 88,075,447 (GRCm39) probably benign Het
Cyp2c66 A G 19: 39,130,369 (GRCm39) Y68C probably damaging Het
Dicer1 G A 12: 104,668,710 (GRCm39) T1324M probably benign Het
Dlgap2 A G 8: 14,777,562 (GRCm39) D268G probably benign Het
Dnm1 T A 2: 32,207,001 (GRCm39) M535L possibly damaging Het
Dock7 A T 4: 98,850,517 (GRCm39) F1575Y probably benign Het
Dpp10 T A 1: 123,326,275 (GRCm39) H403L possibly damaging Het
Dync1h1 A G 12: 110,616,285 (GRCm39) D3112G possibly damaging Het
Eno3 A G 11: 70,548,761 (GRCm39) E21G probably null Het
Fam120b T A 17: 15,643,186 (GRCm39) V655D probably damaging Het
Fkbp5 A T 17: 28,647,426 (GRCm39) D136E probably benign Het
Gdap1l1 T A 2: 163,289,573 (GRCm39) Y179* probably null Het
Gfer A G 17: 24,913,277 (GRCm39) W192R probably damaging Het
Gm4782 A G 6: 50,586,838 (GRCm39) T408A probably benign Het
Golgb1 C T 16: 36,695,992 (GRCm39) Q164* probably null Het
Gpnmb A G 6: 49,024,276 (GRCm39) N197S probably damaging Het
Gtf2f1 G A 17: 57,310,802 (GRCm39) T414M probably benign Het
Hc A G 2: 34,926,166 (GRCm39) probably benign Het
Hcfc1 A T X: 72,992,035 (GRCm39) probably benign Het
Helz2 C T 2: 180,872,223 (GRCm39) R2539Q probably damaging Het
Hsd17b12 T A 2: 93,988,160 (GRCm39) I19F probably benign Het
Incenp T C 19: 9,871,114 (GRCm39) T172A unknown Het
Jmy A G 13: 93,578,126 (GRCm39) Y681H probably benign Het
Kbtbd11 A G 8: 15,077,508 (GRCm39) T36A probably benign Het
Kcnh4 T C 11: 100,646,525 (GRCm39) D267G probably damaging Het
Krt34 C T 11: 99,932,157 (GRCm39) E56K probably damaging Het
Krt40 T A 11: 99,429,568 (GRCm39) E335D probably damaging Het
Krt86 T A 15: 101,374,454 (GRCm39) Y282* probably null Het
Lgi3 C T 14: 70,772,255 (GRCm39) R267* probably null Het
Lnpk A G 2: 74,367,633 (GRCm39) probably benign Het
Lrp1b T A 2: 40,888,195 (GRCm39) H2355L probably benign Het
Lrrc8e G A 8: 4,285,401 (GRCm39) R542H probably benign Het
Mia2 T C 12: 59,155,642 (GRCm39) Y452H probably damaging Het
Mmachc C T 4: 116,561,738 (GRCm39) R132Q probably damaging Het
Mtbp T A 15: 55,440,882 (GRCm39) N356K possibly damaging Het
Myo5b A G 18: 74,794,787 (GRCm39) H552R possibly damaging Het
Niban1 A G 1: 151,593,967 (GRCm39) D884G probably benign Het
Noxred1 A G 12: 87,273,753 (GRCm39) V96A probably benign Het
Nr1d2 T A 14: 18,211,933 (GRCm38) D390V possibly damaging Het
Oas1e A T 5: 120,929,839 (GRCm39) probably benign Het
Odad2 A T 18: 7,211,516 (GRCm39) V786D probably damaging Het
Or1r1 T C 11: 73,874,538 (GRCm39) S299G probably benign Het
Or6c1b T A 10: 129,273,217 (GRCm39) Y179N probably damaging Het
Otog G T 7: 45,916,805 (GRCm39) C914F probably damaging Het
Pank2 G T 2: 131,122,117 (GRCm39) C214F probably damaging Het
Pcdhb1 T A 18: 37,399,788 (GRCm39) S580T probably benign Het
Pdia3 T C 2: 121,244,592 (GRCm39) S2P probably damaging Het
Peli1 G T 11: 21,092,602 (GRCm39) R83L probably damaging Het
Pla2g3 T A 11: 3,441,935 (GRCm39) C366* probably null Het
Pon3 T A 6: 5,240,860 (GRCm39) D107V probably benign Het
Ppip5k2 A G 1: 97,668,816 (GRCm39) C532R probably damaging Het
Prph A T 15: 98,953,608 (GRCm39) D174V probably damaging Het
Psd3 A G 8: 68,210,738 (GRCm39) M270T probably damaging Het
Pum3 A G 19: 27,400,155 (GRCm39) probably benign Het
Pus1 A T 5: 110,927,664 (GRCm39) H30Q probably benign Het
Pwwp3a T C 10: 80,070,092 (GRCm39) S354P probably benign Het
Rab7 A T 6: 87,982,114 (GRCm39) V87E probably damaging Het
Rbm5 A T 9: 107,628,907 (GRCm39) probably benign Het
Reln A G 5: 22,147,595 (GRCm39) probably null Het
S1pr3 A G 13: 51,572,938 (GRCm39) T40A probably benign Het
Sdk1 T A 5: 142,129,677 (GRCm39) probably benign Het
Senp7 T A 16: 55,999,884 (GRCm39) I853N probably damaging Het
Serpinb6c T A 13: 34,083,230 (GRCm39) probably benign Het
Shroom1 T G 11: 53,356,312 (GRCm39) probably null Het
Slc24a3 T C 2: 145,448,584 (GRCm39) I376T probably benign Het
Slc46a1 T C 11: 78,359,493 (GRCm39) I375T possibly damaging Het
Slc4a9 T C 18: 36,666,733 (GRCm39) F527S probably damaging Het
Slc4a9 T A 18: 36,674,286 (GRCm39) I924N probably damaging Het
Slx4 T A 16: 3,804,816 (GRCm39) E666V probably damaging Het
Snrnp27 G A 6: 86,652,575 (GRCm39) probably benign Het
Sorcs1 C T 19: 50,216,659 (GRCm39) G640E probably damaging Het
Spmap2l G T 5: 77,164,152 (GRCm39) E52* probably null Het
Sptan1 A T 2: 29,908,413 (GRCm39) M1725L probably benign Het
Sync G A 4: 129,187,514 (GRCm39) R182K probably damaging Het
Syne2 G A 12: 76,144,808 (GRCm39) G1586S probably damaging Het
Sytl1 G T 4: 132,980,768 (GRCm39) T522K probably damaging Het
Tex2 T A 11: 106,410,781 (GRCm39) K414* probably null Het
Tex55 C T 16: 38,644,929 (GRCm39) probably benign Het
Thsd7a G A 6: 12,503,915 (GRCm39) T413I probably benign Het
Tm9sf1 C T 14: 55,875,392 (GRCm39) A451T possibly damaging Het
Ttn A T 2: 76,656,496 (GRCm39) probably benign Het
Uba2 T C 7: 33,854,054 (GRCm39) I140V possibly damaging Het
Ushbp1 C A 8: 71,842,762 (GRCm39) G361* probably null Het
Wbp2nl C T 15: 82,197,988 (GRCm39) A175V probably benign Het
Zc3h12d A G 10: 7,738,330 (GRCm39) E212G probably damaging Het
Zc3h7b T C 15: 81,653,031 (GRCm39) probably benign Het
Other mutations in Cdcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cdcp1 APN 9 123,009,066 (GRCm39) nonsense probably null
IGL01883:Cdcp1 APN 9 123,012,663 (GRCm39) missense probably benign 0.18
IGL02029:Cdcp1 APN 9 123,012,899 (GRCm39) splice site probably benign
IGL02115:Cdcp1 APN 9 123,014,462 (GRCm39) missense probably damaging 1.00
IGL02516:Cdcp1 APN 9 123,002,702 (GRCm39) missense possibly damaging 0.86
IGL02709:Cdcp1 APN 9 123,002,879 (GRCm39) missense probably damaging 1.00
IGL03263:Cdcp1 APN 9 123,009,152 (GRCm39) missense probably benign 0.12
IGL03406:Cdcp1 APN 9 123,014,378 (GRCm39) missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123,009,237 (GRCm39) missense probably benign 0.00
R0939:Cdcp1 UTSW 9 123,012,755 (GRCm39) missense probably damaging 1.00
R1411:Cdcp1 UTSW 9 123,019,177 (GRCm39) missense probably damaging 0.99
R1460:Cdcp1 UTSW 9 123,009,092 (GRCm39) missense possibly damaging 0.69
R1538:Cdcp1 UTSW 9 123,002,653 (GRCm39) missense probably damaging 1.00
R1660:Cdcp1 UTSW 9 123,014,427 (GRCm39) missense probably benign 0.09
R1673:Cdcp1 UTSW 9 123,007,086 (GRCm39) nonsense probably null
R1794:Cdcp1 UTSW 9 123,044,896 (GRCm39) missense probably benign
R1794:Cdcp1 UTSW 9 123,019,159 (GRCm39) missense probably benign 0.37
R2472:Cdcp1 UTSW 9 123,014,172 (GRCm39) missense probably benign 0.07
R3961:Cdcp1 UTSW 9 123,011,446 (GRCm39) missense possibly damaging 0.73
R3962:Cdcp1 UTSW 9 123,011,446 (GRCm39) missense possibly damaging 0.73
R4288:Cdcp1 UTSW 9 123,012,693 (GRCm39) missense probably damaging 0.99
R4888:Cdcp1 UTSW 9 123,011,194 (GRCm39) intron probably benign
R4953:Cdcp1 UTSW 9 123,009,088 (GRCm39) missense probably benign 0.00
R5236:Cdcp1 UTSW 9 123,014,258 (GRCm39) missense probably damaging 1.00
R5546:Cdcp1 UTSW 9 123,007,094 (GRCm39) missense probably damaging 1.00
R5848:Cdcp1 UTSW 9 123,012,770 (GRCm39) missense possibly damaging 0.87
R5903:Cdcp1 UTSW 9 123,002,837 (GRCm39) nonsense probably null
R6052:Cdcp1 UTSW 9 123,014,396 (GRCm39) missense probably benign 0.04
R6344:Cdcp1 UTSW 9 123,011,447 (GRCm39) missense possibly damaging 0.69
R6904:Cdcp1 UTSW 9 123,002,980 (GRCm39) missense probably benign
R7038:Cdcp1 UTSW 9 123,002,662 (GRCm39) missense probably damaging 1.00
R7092:Cdcp1 UTSW 9 123,012,678 (GRCm39) missense probably benign 0.20
R7262:Cdcp1 UTSW 9 123,002,680 (GRCm39) missense probably damaging 1.00
R7275:Cdcp1 UTSW 9 123,014,119 (GRCm39) missense possibly damaging 0.79
R7294:Cdcp1 UTSW 9 123,006,986 (GRCm39) missense probably benign 0.01
R7373:Cdcp1 UTSW 9 123,006,965 (GRCm39) missense probably damaging 1.00
R7394:Cdcp1 UTSW 9 123,002,878 (GRCm39) missense probably damaging 1.00
R7527:Cdcp1 UTSW 9 123,014,172 (GRCm39) missense probably benign 0.26
R7674:Cdcp1 UTSW 9 123,045,071 (GRCm39) start gained probably benign
R7680:Cdcp1 UTSW 9 123,012,584 (GRCm39) missense probably damaging 1.00
R8079:Cdcp1 UTSW 9 123,002,855 (GRCm39) missense probably damaging 1.00
R8355:Cdcp1 UTSW 9 123,002,888 (GRCm39) missense probably benign 0.16
R8749:Cdcp1 UTSW 9 123,019,027 (GRCm39) missense probably benign 0.02
R8770:Cdcp1 UTSW 9 123,006,926 (GRCm39) missense possibly damaging 0.73
R8964:Cdcp1 UTSW 9 123,012,561 (GRCm39) nonsense probably null
R9241:Cdcp1 UTSW 9 123,014,301 (GRCm39) missense probably damaging 1.00
R9520:Cdcp1 UTSW 9 123,012,736 (GRCm39) missense possibly damaging 0.87
X0028:Cdcp1 UTSW 9 123,014,249 (GRCm39) missense probably damaging 1.00
Predicted Primers PCR Primer

Sequencing Primer
(F):5'- tgtaaactgtgagtcaaaaaaccc -3'
Posted On 2013-07-11