Incidental Mutation 'R0242:Cdcp1'
ID59567
Institutional Source Beutler Lab
Gene Symbol Cdcp1
Ensembl Gene ENSMUSG00000035498
Gene NameCUB domain containing protein 1
Synonyms
MMRRC Submission 038480-MU
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R0242 (G1)
Quality Score225
Status Validated
Chromosome9
Chromosomal Location123170824-123216038 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 123180172 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Leucine at position 480 (F480L)
Ref Sequence ENSEMBL: ENSMUSP00000042057 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000039229]
Predicted Effect probably benign
Transcript: ENSMUST00000039229
AA Change: F480L

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000042057
Gene: ENSMUSG00000035498
AA Change: F480L

DomainStartEndE-ValueType
signal peptide 1 29 N/A INTRINSIC
internal_repeat_1 56 267 1.33e-11 PROSPERO
internal_repeat_1 374 591 1.33e-11 PROSPERO
transmembrane domain 668 690 N/A INTRINSIC
low complexity region 770 782 N/A INTRINSIC
low complexity region 792 802 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000140915
Predicted Effect noncoding transcript
Transcript: ENSMUST00000148158
Meta Mutation Damage Score 0.0834 question?
Coding Region Coverage
  • 1x: 99.4%
  • 3x: 98.8%
  • 10x: 97.3%
  • 20x: 94.5%
Validation Efficiency 97% (110/113)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a transmembrane protein which contains three extracellular CUB domains and acts as a substrate for Src family kinases. The protein plays a role in the tyrosine phosphorylation-dependent regulation of cellular events that are involved in tumor invasion and metastasis. Alternative splicing results in multiple transcript variants of this gene. [provided by RefSeq, May 2013]
PHENOTYPE: Mice homozygous for a knock-out allele are viable and fertile. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 110 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700029H14Rik T C 8: 13,551,676 D230G probably benign Het
4930435E12Rik C T 16: 38,824,567 probably benign Het
Abhd13 A G 8: 9,987,561 I53V probably benign Het
Adgrl2 A C 3: 148,839,185 probably null Het
Aldh16a1 G A 7: 45,144,664 A596V probably damaging Het
Aldh3b2 T A 19: 3,979,414 Y262* probably null Het
Ambn A G 5: 88,467,972 Q420R possibly damaging Het
Ankib1 A C 5: 3,700,344 probably benign Het
Arhgap9 C A 10: 127,329,538 H430Q probably benign Het
Arhgef25 C T 10: 127,184,064 G435E probably damaging Het
Armc12 A T 17: 28,532,392 D120V possibly damaging Het
Armc4 A T 18: 7,211,516 V786D probably damaging Het
Asxl3 G A 18: 22,516,681 E576K possibly damaging Het
Bcdin3d T C 15: 99,470,895 E141G probably benign Het
Bmpr1b G A 3: 141,840,676 T483M probably damaging Het
Caprin2 C T 6: 148,842,954 S991N probably damaging Het
Cd96 T C 16: 46,071,766 I286M possibly damaging Het
Celf5 T C 10: 81,464,409 T258A probably benign Het
Cgnl1 A G 9: 71,721,657 V577A probably damaging Het
Clca3b A G 3: 144,841,465 S304P probably benign Het
Cmya5 A T 13: 93,095,600 H993Q probably benign Het
Cnbp A T 6: 87,845,764 C6S probably damaging Het
Col14a1 C T 15: 55,497,511 R1605W probably damaging Het
Cops7a T C 6: 124,964,854 N11S probably benign Het
Coro7 T C 16: 4,630,178 probably benign Het
Cpvl T C 6: 53,932,500 H217R possibly damaging Het
Cuedc1 T C 11: 88,184,621 probably benign Het
Cyp2c66 A G 19: 39,141,925 Y68C probably damaging Het
Dicer1 G A 12: 104,702,451 T1324M probably benign Het
Dlgap2 A G 8: 14,727,562 D268G probably benign Het
Dnm1 T A 2: 32,316,989 M535L possibly damaging Het
Dock7 A T 4: 98,962,280 F1575Y probably benign Het
Dpp10 T A 1: 123,398,546 H403L possibly damaging Het
Dync1h1 A G 12: 110,649,851 D3112G possibly damaging Het
Eno3 A G 11: 70,657,935 E21G probably null Het
Fam120b T A 17: 15,422,924 V655D probably damaging Het
Fam129a A G 1: 151,718,216 D884G probably benign Het
Fkbp5 A T 17: 28,428,452 D136E probably benign Het
Gdap1l1 T A 2: 163,447,653 Y179* probably null Het
Gfer A G 17: 24,694,303 W192R probably damaging Het
Gm4782 A G 6: 50,609,858 T408A probably benign Het
Golgb1 C T 16: 36,875,630 Q164* probably null Het
Gpnmb A G 6: 49,047,342 N197S probably damaging Het
Gtf2f1 G A 17: 57,003,802 T414M probably benign Het
Hc A G 2: 35,036,154 probably benign Het
Hcfc1 A T X: 73,948,429 probably benign Het
Helz2 C T 2: 181,230,430 R2539Q probably damaging Het
Hsd17b12 T A 2: 94,157,815 I19F probably benign Het
Incenp T C 19: 9,893,750 T172A unknown Het
Jmy A G 13: 93,441,618 Y681H probably benign Het
Kbtbd11 A G 8: 15,027,508 T36A probably benign Het
Kcnh4 T C 11: 100,755,699 D267G probably damaging Het
Krt34 C T 11: 100,041,331 E56K probably damaging Het
Krt40 T A 11: 99,538,742 E335D probably damaging Het
Krt86 T A 15: 101,476,573 Y282* probably null Het
Lgi3 C T 14: 70,534,815 R267* probably null Het
Lnpk A G 2: 74,537,289 probably benign Het
Lrp1b T A 2: 40,998,183 H2355L probably benign Het
Lrrc8e G A 8: 4,235,401 R542H probably benign Het
Mia2 T C 12: 59,108,856 Y452H probably damaging Het
Mmachc C T 4: 116,704,541 R132Q probably damaging Het
Mtbp T A 15: 55,577,486 N356K possibly damaging Het
Mum1 T C 10: 80,234,258 S354P probably benign Het
Myo5b A G 18: 74,661,716 H552R possibly damaging Het
Noxred1 A G 12: 87,226,979 V96A probably benign Het
Nr1d2 T A 14: 18,211,933 D390V possibly damaging Het
Oas1e A T 5: 120,791,774 probably benign Het
Olfr398 T C 11: 73,983,712 S299G probably benign Het
Olfr786 T A 10: 129,437,348 Y179N probably damaging Het
Otog G T 7: 46,267,381 C914F probably damaging Het
Pank2 G T 2: 131,280,197 C214F probably damaging Het
Pcdhb1 T A 18: 37,266,735 S580T probably benign Het
Pdia3 T C 2: 121,414,111 S2P probably damaging Het
Peli1 G T 11: 21,142,602 R83L probably damaging Het
Pla2g3 T A 11: 3,491,935 C366* probably null Het
Pon3 T A 6: 5,240,860 D107V probably benign Het
Ppip5k2 A G 1: 97,741,091 C532R probably damaging Het
Prph A T 15: 99,055,727 D174V probably damaging Het
Psd3 A G 8: 67,758,086 M270T probably damaging Het
Pum3 A G 19: 27,422,755 probably benign Het
Pus1 A T 5: 110,779,798 H30Q probably benign Het
Rab7 A T 6: 88,005,132 V87E probably damaging Het
Rbm5 A T 9: 107,751,708 probably benign Het
Reln A G 5: 21,942,597 probably null Het
S1pr3 A G 13: 51,418,902 T40A probably benign Het
Sdk1 T A 5: 142,143,922 probably benign Het
Senp7 T A 16: 56,179,521 I853N probably damaging Het
Serpinb6c T A 13: 33,899,247 probably benign Het
Shroom1 T G 11: 53,465,485 probably null Het
Slc24a3 T C 2: 145,606,664 I376T probably benign Het
Slc46a1 T C 11: 78,468,667 I375T possibly damaging Het
Slc4a9 T C 18: 36,533,680 F527S probably damaging Het
Slc4a9 T A 18: 36,541,233 I924N probably damaging Het
Slx4 T A 16: 3,986,952 E666V probably damaging Het
Snrnp27 G A 6: 86,675,593 probably benign Het
Sorcs1 C T 19: 50,228,221 G640E probably damaging Het
Sptan1 A T 2: 30,018,401 M1725L probably benign Het
Sync G A 4: 129,293,721 R182K probably damaging Het
Syne2 G A 12: 76,098,034 G1586S probably damaging Het
Sytl1 G T 4: 133,253,457 T522K probably damaging Het
Tex2 T A 11: 106,519,955 K414* probably null Het
Thegl G T 5: 77,016,305 E52* probably null Het
Thsd7a G A 6: 12,503,916 T413I probably benign Het
Tm9sf1 C T 14: 55,637,935 A451T possibly damaging Het
Ttn A T 2: 76,826,152 probably benign Het
Uba2 T C 7: 34,154,629 I140V possibly damaging Het
Ushbp1 C A 8: 71,390,118 G361* probably null Het
Wbp2nl C T 15: 82,313,787 A175V probably benign Het
Zc3h12d A G 10: 7,862,566 E212G probably damaging Het
Zc3h7b T C 15: 81,768,830 probably benign Het
Other mutations in Cdcp1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01757:Cdcp1 APN 9 123180001 nonsense probably null
IGL01883:Cdcp1 APN 9 123183598 missense probably benign 0.18
IGL02029:Cdcp1 APN 9 123183834 splice site probably benign
IGL02115:Cdcp1 APN 9 123185397 missense probably damaging 1.00
IGL02516:Cdcp1 APN 9 123173637 missense possibly damaging 0.86
IGL02709:Cdcp1 APN 9 123173814 missense probably damaging 1.00
IGL03263:Cdcp1 APN 9 123180087 missense probably benign 0.12
IGL03406:Cdcp1 APN 9 123185313 missense probably benign 0.00
R0242:Cdcp1 UTSW 9 123180172 missense probably benign 0.00
R0939:Cdcp1 UTSW 9 123183690 missense probably damaging 1.00
R1411:Cdcp1 UTSW 9 123190112 missense probably damaging 0.99
R1460:Cdcp1 UTSW 9 123180027 missense possibly damaging 0.69
R1538:Cdcp1 UTSW 9 123173588 missense probably damaging 1.00
R1660:Cdcp1 UTSW 9 123185362 missense probably benign 0.09
R1673:Cdcp1 UTSW 9 123178021 nonsense probably null
R1794:Cdcp1 UTSW 9 123190094 missense probably benign 0.37
R1794:Cdcp1 UTSW 9 123215831 missense probably benign
R2472:Cdcp1 UTSW 9 123185107 missense probably benign 0.07
R3961:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R3962:Cdcp1 UTSW 9 123182381 missense possibly damaging 0.73
R4288:Cdcp1 UTSW 9 123183628 missense probably damaging 0.99
R4888:Cdcp1 UTSW 9 123182129 intron probably benign
R4953:Cdcp1 UTSW 9 123180023 missense probably benign 0.00
R5236:Cdcp1 UTSW 9 123185193 missense probably damaging 1.00
R5546:Cdcp1 UTSW 9 123178029 missense probably damaging 1.00
R5848:Cdcp1 UTSW 9 123183705 missense possibly damaging 0.87
R5903:Cdcp1 UTSW 9 123173772 nonsense probably null
R6052:Cdcp1 UTSW 9 123185331 missense probably benign 0.04
R6344:Cdcp1 UTSW 9 123182382 missense possibly damaging 0.69
R6904:Cdcp1 UTSW 9 123173915 missense probably benign
R7038:Cdcp1 UTSW 9 123173597 missense probably damaging 1.00
R7092:Cdcp1 UTSW 9 123183613 missense probably benign 0.20
R7262:Cdcp1 UTSW 9 123173615 missense probably damaging 1.00
R7275:Cdcp1 UTSW 9 123185054 missense possibly damaging 0.79
R7294:Cdcp1 UTSW 9 123177921 missense probably benign 0.01
R7373:Cdcp1 UTSW 9 123177900 missense probably damaging 1.00
R7394:Cdcp1 UTSW 9 123173813 missense probably damaging 1.00
R7527:Cdcp1 UTSW 9 123185107 missense probably benign 0.26
R7674:Cdcp1 UTSW 9 123216006 start gained probably benign
R7680:Cdcp1 UTSW 9 123183519 missense probably damaging 1.00
R8079:Cdcp1 UTSW 9 123173790 missense probably damaging 1.00
R8355:Cdcp1 UTSW 9 123173823 missense probably benign 0.16
R8749:Cdcp1 UTSW 9 123189962 missense probably benign 0.02
R8770:Cdcp1 UTSW 9 123177861 missense possibly damaging 0.73
X0028:Cdcp1 UTSW 9 123185184 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGCACTTCTGATGAGGAGCAAAC -3'
(R):5'- CCCTTGCACATGGGTATCACCAAC -3'

Sequencing Primer
(F):5'- tgtaaactgtgagtcaaaaaaccc -3'
(R):5'- GACCACCGCTACTGCTATAGG -3'
Posted On2013-07-11