Incidental Mutation 'R7729:Slco6d1'
ID595675
Institutional Source Beutler Lab
Gene Symbol Slco6d1
Ensembl Gene ENSMUSG00000026336
Gene Namesolute carrier organic anion transporter family, member 6d1
Synonyms4921511I05Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.057) question?
Stock #R7729 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location98421124-98516991 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98497523 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Serine at position 599 (T599S)
Ref Sequence ENSEMBL: ENSMUSP00000027575 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000027575] [ENSMUST00000160796] [ENSMUST00000162468]
Predicted Effect probably damaging
Transcript: ENSMUST00000027575
AA Change: T599S

PolyPhen 2 Score 0.980 (Sensitivity: 0.75; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000027575
Gene: ENSMUSG00000026336
AA Change: T599S

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 1.8e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000160796
AA Change: T599S

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000123850
Gene: ENSMUSG00000026336
AA Change: T599S

DomainStartEndE-ValueType
Pfam:MFS_1 86 463 2.4e-13 PFAM
KAZAL 483 527 2.3e0 SMART
low complexity region 558 572 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162468
SMART Domains Protein: ENSMUSP00000125258
Gene: ENSMUSG00000026336

DomainStartEndE-ValueType
Pfam:OATP 64 313 2.1e-27 PFAM
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Adgrb2 C T 4: 129,992,124 T19M probably benign Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Ddx58 T A 4: 40,206,034 I853F possibly damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Dock7 G A 4: 99,055,446 P520S Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Eprs T A 1: 185,413,169 Y1130N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Gata4 C A 14: 63,240,737 A138S probably benign Het
Golga4 A G 9: 118,556,063 H751R possibly damaging Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rcor3 A G 1: 192,101,778 Y387H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slc35d1 C T 4: 103,214,847 R7H probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgfb2 C A 1: 186,630,757 G290V possibly damaging Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Slco6d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Slco6d1 APN 1 98432230 splice site probably null
IGL00678:Slco6d1 APN 1 98496344 missense probably benign 0.01
IGL00790:Slco6d1 APN 1 98421200 utr 5 prime probably benign
IGL01694:Slco6d1 APN 1 98499845 missense probably damaging 1.00
IGL02003:Slco6d1 APN 1 98480768 missense probably damaging 1.00
IGL02059:Slco6d1 APN 1 98446806 missense possibly damaging 0.95
IGL02085:Slco6d1 APN 1 98443743 missense probably damaging 1.00
IGL02683:Slco6d1 APN 1 98480672 missense probably benign 0.05
IGL02736:Slco6d1 APN 1 98428311 missense possibly damaging 0.55
IGL03279:Slco6d1 APN 1 98466680 missense probably damaging 1.00
PIT4581001:Slco6d1 UTSW 1 98423325 missense possibly damaging 0.46
R0326:Slco6d1 UTSW 1 98490634 missense probably benign 0.02
R0359:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0554:Slco6d1 UTSW 1 98466697 missense probably benign 0.21
R0589:Slco6d1 UTSW 1 98499747 splice site probably benign
R0733:Slco6d1 UTSW 1 98428269 nonsense probably null
R0883:Slco6d1 UTSW 1 98421399 missense probably benign 0.00
R1316:Slco6d1 UTSW 1 98466793 missense probably benign 0.02
R1370:Slco6d1 UTSW 1 98423094 missense probably benign 0.01
R1401:Slco6d1 UTSW 1 98490616 missense probably damaging 1.00
R1691:Slco6d1 UTSW 1 98507567 missense probably benign 0.34
R1740:Slco6d1 UTSW 1 98428372 missense probably damaging 1.00
R1767:Slco6d1 UTSW 1 98490549 missense possibly damaging 0.90
R1827:Slco6d1 UTSW 1 98421216 missense probably damaging 0.96
R2138:Slco6d1 UTSW 1 98443660 missense probably benign 0.19
R2849:Slco6d1 UTSW 1 98466716 missense probably benign 0.02
R3753:Slco6d1 UTSW 1 98499777 missense probably damaging 0.99
R4066:Slco6d1 UTSW 1 98463846 critical splice acceptor site probably benign
R4429:Slco6d1 UTSW 1 98496366 missense possibly damaging 0.66
R4480:Slco6d1 UTSW 1 98507574 nonsense probably null
R4656:Slco6d1 UTSW 1 98423203 missense probably benign 0.06
R4810:Slco6d1 UTSW 1 98423254 missense possibly damaging 0.83
R4814:Slco6d1 UTSW 1 98423174 missense probably benign 0.15
R5389:Slco6d1 UTSW 1 98443644 missense probably benign 0.00
R5504:Slco6d1 UTSW 1 98421339 missense probably damaging 0.99
R5619:Slco6d1 UTSW 1 98496222 missense probably damaging 1.00
R5688:Slco6d1 UTSW 1 98480768 missense probably damaging 1.00
R5820:Slco6d1 UTSW 1 98499778 missense probably damaging 0.97
R5878:Slco6d1 UTSW 1 98463836 splice site probably benign
R6261:Slco6d1 UTSW 1 98499863 missense probably benign 0.10
R6450:Slco6d1 UTSW 1 98421467 missense probably benign 0.29
R6452:Slco6d1 UTSW 1 98421212 missense probably benign 0.44
R7338:Slco6d1 UTSW 1 98421372 missense probably benign 0.11
R7375:Slco6d1 UTSW 1 98421447 missense probably damaging 1.00
R7456:Slco6d1 UTSW 1 98421357 missense possibly damaging 0.66
R7567:Slco6d1 UTSW 1 98497527 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCCATAAAGTTCTTCCCCATGG -3'
(R):5'- CAATCCAAGGCTTCAGCTGAC -3'

Sequencing Primer
(F):5'- CCCCATGGAAAGAATTTCATTATTTG -3'
(R):5'- GGCTTCAGCTGACACAATATAATTG -3'
Posted On2019-11-12