Incidental Mutation 'R7729:Eprs'
ID595677
Institutional Source Beutler Lab
Gene Symbol Eprs
Ensembl Gene ENSMUSG00000026615
Gene Nameglutamyl-prolyl-tRNA synthetase
Synonyms2410081F06Rik, 3010002K18Rik, Qprs
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7729 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location185363044-185428360 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 185413169 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Asparagine at position 1130 (Y1130N)
Ref Sequence ENSEMBL: ENSMUSP00000045841 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046514]
Predicted Effect probably damaging
Transcript: ENSMUST00000046514
AA Change: Y1130N

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000045841
Gene: ENSMUSG00000026615
AA Change: Y1130N

DomainStartEndE-ValueType
Pfam:GST_C_3 71 156 2.1e-15 PFAM
Pfam:GST_C 72 157 2.9e-7 PFAM
Pfam:tRNA-synt_1c 197 502 8.8e-127 PFAM
Pfam:tRNA-synt_1c_C 504 681 4.4e-42 PFAM
WHEP-TRS 753 815 1.26e-25 SMART
WHEP-TRS 826 888 1.47e-26 SMART
WHEP-TRS 904 966 3.76e-24 SMART
low complexity region 984 1011 N/A INTRINSIC
Pfam:tRNA-synt_2b 1107 1287 3.1e-17 PFAM
Pfam:HGTP_anticodon 1303 1404 1.7e-19 PFAM
ProRS-C_1 1430 1512 5.27e-28 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Aminoacyl-tRNA synthetases are a class of enzymes that charge tRNAs with their cognate amino acids. The protein encoded by this gene is a multifunctional aminoacyl-tRNA synthetase that catalyzes the aminoacylation of glutamic acid and proline tRNA species. Alternative splicing has been observed for this gene, but the full-length nature and biological validity of the variant have not been determined. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a phospho-mimetic allele exhibit normal body weight, life span and glucose metabolism. Mice homozygous for a phospho-deficient allele exhibit decrease body weight, enhanced lipolysis, altered glucose metabolism and increased energy expenditure. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Adgrb2 C T 4: 129,992,124 T19M probably benign Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Ddx58 T A 4: 40,206,034 I853F possibly damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Dock7 G A 4: 99,055,446 P520S Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Gata4 C A 14: 63,240,737 A138S probably benign Het
Golga4 A G 9: 118,556,063 H751R possibly damaging Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rcor3 A G 1: 192,101,778 Y387H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slc35d1 C T 4: 103,214,847 R7H probably damaging Het
Slco6d1 A T 1: 98,497,523 T599S probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgfb2 C A 1: 186,630,757 G290V possibly damaging Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Eprs
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00528:Eprs APN 1 185407148 missense probably benign 0.11
IGL00532:Eprs APN 1 185407148 missense probably benign 0.11
IGL00543:Eprs APN 1 185407148 missense probably benign 0.11
IGL00553:Eprs APN 1 185407148 missense probably benign 0.11
IGL00574:Eprs APN 1 185407148 missense probably benign 0.11
IGL00583:Eprs APN 1 185407148 missense probably benign 0.11
IGL00946:Eprs APN 1 185407701 missense probably benign 0.02
IGL01062:Eprs APN 1 185379615 missense probably benign 0.19
IGL01477:Eprs APN 1 185411375 splice site probably benign
IGL01608:Eprs APN 1 185385114 unclassified probably benign
IGL01767:Eprs APN 1 185384915 missense probably damaging 0.98
IGL02136:Eprs APN 1 185384983 missense probably damaging 1.00
IGL02302:Eprs APN 1 185387124 splice site probably benign
IGL02528:Eprs APN 1 185413489 missense probably damaging 1.00
IGL02631:Eprs APN 1 185427898 missense probably damaging 1.00
IGL02989:Eprs APN 1 185418366 missense probably benign 0.31
IGL03004:Eprs APN 1 185381833 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0003:Eprs UTSW 1 185414391 missense probably damaging 1.00
R0179:Eprs UTSW 1 185413547 missense probably benign
R0783:Eprs UTSW 1 185398458 missense probably damaging 1.00
R1319:Eprs UTSW 1 185384962 missense probably damaging 1.00
R1335:Eprs UTSW 1 185387089 missense probably damaging 1.00
R1514:Eprs UTSW 1 185381834 missense probably damaging 0.99
R1590:Eprs UTSW 1 185401510 missense probably damaging 1.00
R1688:Eprs UTSW 1 185384896 missense probably damaging 0.99
R1725:Eprs UTSW 1 185406992 missense probably damaging 1.00
R2182:Eprs UTSW 1 185379742 splice site probably null
R2228:Eprs UTSW 1 185367537 missense probably damaging 1.00
R2336:Eprs UTSW 1 185411374 splice site probably benign
R2338:Eprs UTSW 1 185415808 missense probably damaging 1.00
R2439:Eprs UTSW 1 185379742 splice site probably null
R2914:Eprs UTSW 1 185379742 splice site probably null
R3001:Eprs UTSW 1 185424391 critical splice donor site probably null
R3002:Eprs UTSW 1 185424391 critical splice donor site probably null
R3003:Eprs UTSW 1 185424391 critical splice donor site probably null
R3547:Eprs UTSW 1 185379742 splice site probably null
R3775:Eprs UTSW 1 185373008 missense probably damaging 1.00
R3878:Eprs UTSW 1 185415953 critical splice donor site probably null
R3902:Eprs UTSW 1 185379742 splice site probably null
R3913:Eprs UTSW 1 185379742 splice site probably null
R4579:Eprs UTSW 1 185401607 missense probably damaging 1.00
R4664:Eprs UTSW 1 185373076 intron probably benign
R4680:Eprs UTSW 1 185386278 missense possibly damaging 0.87
R4712:Eprs UTSW 1 185428108 missense probably benign 0.00
R4749:Eprs UTSW 1 185396130 missense probably damaging 0.97
R4995:Eprs UTSW 1 185410139 intron probably benign
R5154:Eprs UTSW 1 185413465 missense probably damaging 1.00
R5640:Eprs UTSW 1 185374184 missense probably benign 0.34
R5662:Eprs UTSW 1 185394425 missense possibly damaging 0.72
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6037:Eprs UTSW 1 185396109 missense probably damaging 1.00
R6151:Eprs UTSW 1 185407754 critical splice donor site probably null
R6387:Eprs UTSW 1 185387084 missense possibly damaging 0.94
R6647:Eprs UTSW 1 185414424 missense probably damaging 1.00
R6701:Eprs UTSW 1 185370890 missense probably damaging 0.99
R6997:Eprs UTSW 1 185396163 missense possibly damaging 0.50
R7295:Eprs UTSW 1 185418210 critical splice acceptor site probably null
R7305:Eprs UTSW 1 185379701 missense probably damaging 1.00
R7732:Eprs UTSW 1 185372939 missense probably benign 0.01
R7733:Eprs UTSW 1 185397161 missense probably benign
R7826:Eprs UTSW 1 185406968 missense probably damaging 0.96
Predicted Primers PCR Primer
(F):5'- GCATTAGCTCGCTAGGTAGAC -3'
(R):5'- CCAGTCAGCACAGGAAATAGTG -3'

Sequencing Primer
(F):5'- GACCTGTGTCTCTTCAGGATTCTG -3'
(R):5'- GCCACAAATCCTGAGAAG -3'
Posted On2019-11-12