Incidental Mutation 'R7729:Tgfb2'
ID595678
Institutional Source Beutler Lab
Gene Symbol Tgfb2
Ensembl Gene ENSMUSG00000039239
Gene Nametransforming growth factor, beta 2
SynonymsTgfb-2, Tgf-beta2
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7729 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location186622792-186705989 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to A at 186630757 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Valine at position 290 (G290V)
Ref Sequence ENSEMBL: ENSMUSP00000142149 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000045288] [ENSMUST00000195201]
Predicted Effect probably damaging
Transcript: ENSMUST00000045288
AA Change: G262V

PolyPhen 2 Score 0.976 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000043849
Gene: ENSMUSG00000039239
AA Change: G262V

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 20 284 1.1e-38 PFAM
TGFB 317 414 1.25e-37 SMART
Predicted Effect possibly damaging
Transcript: ENSMUST00000195201
AA Change: G290V

PolyPhen 2 Score 0.937 (Sensitivity: 0.80; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000142149
Gene: ENSMUSG00000039239
AA Change: G290V

DomainStartEndE-ValueType
Pfam:TGFb_propeptide 9 138 2.4e-9 PFAM
Pfam:TGFb_propeptide 152 311 1.4e-23 PFAM
TGFB 345 442 6.1e-40 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a secreted ligand of the TGF-beta (transforming growth factor-beta) superfamily of proteins. Ligands of this family bind various TGF-beta receptors leading to recruitment and activation of SMAD family transcription factors that regulate gene expression. The encoded preproprotein is proteolytically processed to generate a latency-associated peptide (LAP) and a mature peptide, and is found in either a latent form composed of a mature peptide homodimer, a LAP homodimer, and a latent TGF-beta binding protein, or in an active form consisting solely of the mature peptide homodimer. The mature peptide may also form heterodimers with other TGF-beta family members. Mice lacking a functional copy of this gene display developmental defects in multiple organs and perinatal lethality. Heterozygous mutant mice exhibit aortic root aneurysm. This gene encodes multiple isoforms that may undergo similar proteolytic processing. [provided by RefSeq, Aug 2016]
PHENOTYPE: Homozygotes for a targeted null mutation exhibit defects of the heart, lungs, skull, limbs, spinal column, eyes, inner ears, and urogenital system, and perinatal mortality. Heterozygotes show abnormalities of the Cowpers' gland and intestinal mucosa. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Adgrb2 C T 4: 129,992,124 T19M probably benign Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Ddx58 T A 4: 40,206,034 I853F possibly damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Dock7 G A 4: 99,055,446 P520S Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Eprs T A 1: 185,413,169 Y1130N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Gata4 C A 14: 63,240,737 A138S probably benign Het
Golga4 A G 9: 118,556,063 H751R possibly damaging Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rcor3 A G 1: 192,101,778 Y387H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slc35d1 C T 4: 103,214,847 R7H probably damaging Het
Slco6d1 A T 1: 98,497,523 T599S probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Tgfb2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00959:Tgfb2 APN 1 186704587 missense probably benign 0.39
IGL01304:Tgfb2 APN 1 186625473 missense probably damaging 0.99
IGL03028:Tgfb2 APN 1 186630609 critical splice donor site probably null
concise UTSW 1 186625513 missense probably benign 0.21
PIT4486001:Tgfb2 UTSW 1 186690727 missense probably benign 0.04
R2017:Tgfb2 UTSW 1 186630765 nonsense probably null
R2880:Tgfb2 UTSW 1 186704555 missense probably damaging 1.00
R4182:Tgfb2 UTSW 1 186629025 missense possibly damaging 0.95
R4292:Tgfb2 UTSW 1 186632538 missense probably damaging 1.00
R4478:Tgfb2 UTSW 1 186632499 missense probably damaging 1.00
R4801:Tgfb2 UTSW 1 186628913 nonsense probably null
R4802:Tgfb2 UTSW 1 186628913 nonsense probably null
R5247:Tgfb2 UTSW 1 186649914 intron probably null
R5254:Tgfb2 UTSW 1 186704483 missense probably damaging 1.00
R5614:Tgfb2 UTSW 1 186625513 missense probably benign 0.21
R5988:Tgfb2 UTSW 1 186704581 missense probably benign 0.05
R6898:Tgfb2 UTSW 1 186632500 missense probably damaging 1.00
R6961:Tgfb2 UTSW 1 186649835 missense possibly damaging 0.67
R7098:Tgfb2 UTSW 1 186630637 missense probably damaging 1.00
R7346:Tgfb2 UTSW 1 186649880 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- AAGCAGTGACTTCAGCTCAG -3'
(R):5'- GCCAGTTAATGAGGCTGTGG -3'

Sequencing Primer
(F):5'- CTTCAGCTCAGGTCAATAATGTACGG -3'
(R):5'- CCAGTTAATGAGGCTGTGGTAGTC -3'
Posted On2019-11-12