Incidental Mutation 'R7729:Rcor3'
ID595679
Institutional Source Beutler Lab
Gene Symbol Rcor3
Ensembl Gene ENSMUSG00000037395
Gene NameREST corepressor 3
SynonymsE130101E15Rik, C730034D20Rik, 4921514E24Rik
Accession Numbers
Is this an essential gene? Possibly essential (E-score: 0.555) question?
Stock #R7729 (G1)
Quality Score225.009
Status Not validated
Chromosome1
Chromosomal Location192098546-192138062 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 192101778 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Histidine at position 387 (Y387H)
Ref Sequence ENSEMBL: ENSMUSP00000141637 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000073279] [ENSMUST00000110849] [ENSMUST00000192128] [ENSMUST00000192158] [ENSMUST00000192222] [ENSMUST00000192491] [ENSMUST00000192866]
Predicted Effect probably benign
Transcript: ENSMUST00000073279
SMART Domains Protein: ENSMUSP00000073004
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 349 363 N/A INTRINSIC
low complexity region 370 384 N/A INTRINSIC
low complexity region 398 414 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000110849
SMART Domains Protein: ENSMUSP00000106473
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 3.89e-14 SMART
SANT 141 189 4.56e-8 SMART
low complexity region 357 374 N/A INTRINSIC
low complexity region 397 413 N/A INTRINSIC
low complexity region 418 433 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192128
AA Change: Y387H

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141637
Gene: ENSMUSG00000037395
AA Change: Y387H

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192158
SMART Domains Protein: ENSMUSP00000141841
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 98 6.6e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000192222
Predicted Effect probably benign
Transcript: ENSMUST00000192491
SMART Domains Protein: ENSMUSP00000141753
Gene: ENSMUSG00000037395

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000192866
AA Change: Y387H

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000142054
Gene: ENSMUSG00000037395
AA Change: Y387H

DomainStartEndE-ValueType
low complexity region 17 36 N/A INTRINSIC
ELM2 57 110 1.8e-18 SMART
SANT 141 189 2.8e-10 SMART
coiled coil region 292 329 N/A INTRINSIC
SANT 342 390 7.5e-13 SMART
low complexity region 449 463 N/A INTRINSIC
low complexity region 470 484 N/A INTRINSIC
low complexity region 498 514 N/A INTRINSIC
Predicted Effect
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Adgrb2 C T 4: 129,992,124 T19M probably benign Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Ddx58 T A 4: 40,206,034 I853F possibly damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Dock7 G A 4: 99,055,446 P520S Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Eprs T A 1: 185,413,169 Y1130N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Gata4 C A 14: 63,240,737 A138S probably benign Het
Golga4 A G 9: 118,556,063 H751R possibly damaging Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slc35d1 C T 4: 103,214,847 R7H probably damaging Het
Slco6d1 A T 1: 98,497,523 T599S probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgfb2 C A 1: 186,630,757 G290V possibly damaging Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Rcor3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00505:Rcor3 APN 1 192127971 unclassified probably benign
IGL01688:Rcor3 APN 1 192123600 missense probably damaging 1.00
IGL01905:Rcor3 APN 1 192101002 missense probably damaging 1.00
R0523:Rcor3 UTSW 1 192130436 missense probably damaging 1.00
R1305:Rcor3 UTSW 1 192116346 missense possibly damaging 0.50
R1847:Rcor3 UTSW 1 192100833 missense possibly damaging 0.83
R1850:Rcor3 UTSW 1 192120111 missense probably benign
R3938:Rcor3 UTSW 1 192101085 missense possibly damaging 0.92
R4403:Rcor3 UTSW 1 192119912 splice site probably null
R4590:Rcor3 UTSW 1 192125917 missense probably damaging 1.00
R4750:Rcor3 UTSW 1 192130449 missense probably damaging 1.00
R5219:Rcor3 UTSW 1 192137513 utr 5 prime probably benign
R5617:Rcor3 UTSW 1 192120130 missense probably benign 0.09
R6059:Rcor3 UTSW 1 192119940 missense probably benign 0.21
R6156:Rcor3 UTSW 1 192127842 unclassified probably benign
R6250:Rcor3 UTSW 1 192100896 missense probably damaging 1.00
R6258:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6260:Rcor3 UTSW 1 192124259 missense probably benign 0.27
R6808:Rcor3 UTSW 1 192137882 missense possibly damaging 0.79
R7194:Rcor3 UTSW 1 192125961 missense possibly damaging 0.88
R7387:Rcor3 UTSW 1 192137524 start gained probably benign
R7402:Rcor3 UTSW 1 192127983 missense probably benign 0.00
R7407:Rcor3 UTSW 1 192101672 missense probably benign
R7432:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7451:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7452:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7570:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7571:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7572:Rcor3 UTSW 1 192137876 missense probably damaging 1.00
R7718:Rcor3 UTSW 1 192101721 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GCTCCTCAGCTCAGATTAGC -3'
(R):5'- TGAGAGCTGAGCAGAGTTTATCAG -3'

Sequencing Primer
(F):5'- GCTCAGATTAGCTCAGATTCCAG -3'
(R):5'- GCAGAGTTTATCAGAAAGGTCGTTC -3'
Posted On2019-11-12