Incidental Mutation 'R7729:Lrba'
ID 595685
Institutional Source Beutler Lab
Gene Symbol Lrba
Ensembl Gene ENSMUSG00000028080
Gene Name LPS-responsive beige-like anchor
Synonyms Lba, D3Ertd775e
MMRRC Submission 045785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 3
Chromosomal Location 86131987-86689999 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) T to A at 86225474 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Glutamic Acid at position 666 (V666E)
Ref Sequence ENSEMBL: ENSMUSP00000103261 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000107635] [ENSMUST00000192145] [ENSMUST00000194759] [ENSMUST00000212390]
AlphaFold no structure available at present
Predicted Effect probably damaging
Transcript: ENSMUST00000107635
AA Change: V666E

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000103261
Gene: ENSMUSG00000028080
AA Change: V666E

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 211 377 4.6e-13 PFAM
Pfam:DUF4704 446 717 2.5e-109 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2049 7e-88 PFAM
Pfam:PH_BEACH 2075 2172 9.1e-31 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
WD40 2760 2798 1.79e-1 SMART
WD40 2801 2840 4.28e0 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000192145
AA Change: V666E

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000142179
Gene: ENSMUSG00000028080
AA Change: V666E

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 7.4e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.5e-92 PFAM
Pfam:PH_BEACH 2068 2172 7.5e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000194759
AA Change: V666E

PolyPhen 2 Score 0.972 (Sensitivity: 0.77; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000142043
Gene: ENSMUSG00000028080
AA Change: V666E

DomainStartEndE-ValueType
low complexity region 12 31 N/A INTRINSIC
Pfam:Laminin_G_3 205 377 8.1e-18 PFAM
coiled coil region 1019 1037 N/A INTRINSIC
low complexity region 1073 1089 N/A INTRINSIC
low complexity region 1100 1113 N/A INTRINSIC
low complexity region 1585 1600 N/A INTRINSIC
low complexity region 1614 1630 N/A INTRINSIC
low complexity region 1698 1713 N/A INTRINSIC
low complexity region 1738 1757 N/A INTRINSIC
low complexity region 1848 1861 N/A INTRINSIC
Pfam:DUF1088 1882 2050 1.6e-92 PFAM
Pfam:PH_BEACH 2068 2172 8.3e-32 PFAM
Beach 2203 2480 2.87e-207 SMART
WD40 2578 2615 7.4e0 SMART
WD40 2618 2661 1.72e0 SMART
WD40 2677 2716 3.99e-1 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000212390
AA Change: V666E

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a member of the WDL-BEACH-WD (WBW) gene family. Its expression is induced in B cells and macrophages by bacterial lipopolysaccharides (LPS). The encoded protein associates with protein kinase A and may be involved in leading intracellular vesicles to activated receptor complexes, which aids in the secretion and/or membrane deposition of immune effector molecules. Defects in this gene are associated with the disorder common variable immunodeficiency-8 with autoimmunity. Two transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit increased numbers of myeloid-derived suppressor cells and regulatory T cells, abnormal NK cell physiology, impaired rejection of allogeneic, xenogeneic and missing self bone-marrow grafts, and resistance to acute graft vs host disease. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T G 2: 127,028,710 (GRCm39) D163A possibly damaging Het
Abce1 A T 8: 80,414,537 (GRCm39) I454N probably damaging Het
Acaca A G 11: 84,262,339 (GRCm39) I1980M probably damaging Het
Adgrb2 C T 4: 129,885,917 (GRCm39) T19M probably benign Het
Agmo T A 12: 37,464,974 (GRCm39) S417T probably benign Het
Akap8l T C 17: 32,552,068 (GRCm39) E403G probably damaging Het
Art5 C T 7: 101,747,711 (GRCm39) A23T possibly damaging Het
Atg9a T C 1: 75,161,204 (GRCm39) T681A probably benign Het
Atp11b A G 3: 35,832,256 (GRCm39) Q37R probably damaging Het
Atp2a2 T C 5: 122,629,829 (GRCm39) E80G probably benign Het
AW551984 G A 9: 39,511,071 (GRCm39) P172L possibly damaging Het
Bace1 C T 9: 45,769,743 (GRCm39) R296C probably damaging Het
Ccser1 T A 6: 61,288,840 (GRCm39) H334Q probably benign Het
Chtf18 C T 17: 25,942,491 (GRCm39) R449H probably damaging Het
Cit A G 5: 116,122,881 (GRCm39) H1384R possibly damaging Het
Cltc A G 11: 86,612,474 (GRCm39) I524T probably benign Het
Dctn1 T A 6: 83,160,042 (GRCm39) I94N probably damaging Het
Dnhd1 A T 7: 105,354,472 (GRCm39) D3078V probably damaging Het
Dock7 G A 4: 98,943,683 (GRCm39) P520S Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Eprs1 T A 1: 185,145,366 (GRCm39) Y1130N probably damaging Het
Fcgrt T C 7: 44,744,797 (GRCm39) T224A probably damaging Het
Flt1 T A 5: 147,637,177 (GRCm39) T39S probably benign Het
Fxyd1 T C 7: 30,752,896 (GRCm39) Y33C probably damaging Het
Gab2 T A 7: 96,950,633 (GRCm39) V442E probably damaging Het
Ganab A G 19: 8,892,076 (GRCm39) D800G probably benign Het
Gata4 C A 14: 63,478,186 (GRCm39) A138S probably benign Het
Golga4 A G 9: 118,385,131 (GRCm39) H751R possibly damaging Het
H1f6 A G 13: 23,880,455 (GRCm39) R203G possibly damaging Het
Htra4 A G 8: 25,527,093 (GRCm39) V234A possibly damaging Het
Igkv4-74 A T 6: 69,161,954 (GRCm39) Y72N probably damaging Het
Iqsec3 T C 6: 121,360,940 (GRCm39) K973E probably damaging Het
Khdc1b C A 1: 21,455,065 (GRCm39) T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Kyat3 A G 3: 142,432,066 (GRCm39) probably null Het
Mettl25 T A 10: 105,601,871 (GRCm39) Y528F probably benign Het
Mms19 A T 19: 41,940,904 (GRCm39) Y619* probably null Het
Nlrp12 A C 7: 3,277,020 (GRCm39) probably null Het
Nol10 C T 12: 17,474,676 (GRCm39) L623F possibly damaging Het
Oas1g A G 5: 121,024,063 (GRCm39) F82S probably damaging Het
Or1j8 T G 2: 36,191,772 (GRCm39) S74A probably benign Het
Or5k3 C T 16: 58,969,570 (GRCm39) A119V probably damaging Het
Or8g18 G A 9: 39,149,546 (GRCm39) P58L probably benign Het
Oxr1 G A 15: 41,686,863 (GRCm39) E582K probably damaging Het
Pdia3 A G 2: 121,262,838 (GRCm39) D268G possibly damaging Het
Pramel13 T C 4: 144,119,434 (GRCm39) S378G probably damaging Het
Rcor3 A G 1: 191,786,078 (GRCm39) Y387H probably damaging Het
Rigi T A 4: 40,206,034 (GRCm39) I853F possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Rsl1 T C 13: 67,330,284 (GRCm39) L244P possibly damaging Het
Scn5a G T 9: 119,324,606 (GRCm39) N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 (GRCm39) A24V probably benign Het
Slc22a8 A G 19: 8,571,323 (GRCm39) Y18C possibly damaging Het
Slc35d1 C T 4: 103,072,044 (GRCm39) R7H probably damaging Het
Slco6d1 A T 1: 98,425,248 (GRCm39) T599S probably damaging Het
Spata31d1e C T 13: 59,889,437 (GRCm39) M794I not run Het
St18 T A 1: 6,872,761 (GRCm39) H165Q probably benign Het
Sub1 C T 15: 11,986,589 (GRCm39) R86K probably damaging Het
Tectb G A 19: 55,181,104 (GRCm39) V148M Het
Tgfb2 C A 1: 186,362,954 (GRCm39) G290V possibly damaging Het
Tgm7 T C 2: 120,924,191 (GRCm39) H577R probably benign Het
Tle2 T C 10: 81,422,981 (GRCm39) S460P probably damaging Het
Tmem221 C A 8: 72,011,446 (GRCm39) R3L possibly damaging Het
Tnfrsf19 C A 14: 61,212,183 (GRCm39) V156L possibly damaging Het
Trav6-5 A G 14: 53,728,964 (GRCm39) K75E probably benign Het
Trip10 G A 17: 57,569,442 (GRCm39) G488S probably damaging Het
Usp34 A C 11: 23,399,268 (GRCm39) K2419T Het
Vps13d T C 4: 144,801,622 (GRCm39) Q3532R Het
Vps4a A T 8: 107,767,529 (GRCm39) I163L probably damaging Het
Wrn T C 8: 33,814,454 (GRCm39) H330R probably benign Het
Xpr1 T C 1: 155,188,618 (GRCm39) I341V probably benign Het
Zfyve9 T C 4: 108,548,973 (GRCm39) E105G probably benign Het
Other mutations in Lrba
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00420:Lrba APN 3 86,267,089 (GRCm39) missense probably benign 0.00
IGL00788:Lrba APN 3 86,234,992 (GRCm39) missense probably damaging 0.97
IGL01139:Lrba APN 3 86,549,969 (GRCm39) missense possibly damaging 0.88
IGL01302:Lrba APN 3 86,202,707 (GRCm39) missense probably damaging 1.00
IGL01612:Lrba APN 3 86,683,484 (GRCm39) missense possibly damaging 0.89
IGL01718:Lrba APN 3 86,258,555 (GRCm39) missense probably damaging 1.00
IGL01719:Lrba APN 3 86,234,903 (GRCm39) splice site probably benign
IGL01730:Lrba APN 3 86,648,731 (GRCm39) missense possibly damaging 0.89
IGL01735:Lrba APN 3 86,234,968 (GRCm39) missense probably benign 0.28
IGL01875:Lrba APN 3 86,217,354 (GRCm39) missense probably damaging 1.00
IGL01884:Lrba APN 3 86,217,719 (GRCm39) missense possibly damaging 0.86
IGL02264:Lrba APN 3 86,687,569 (GRCm39) missense probably damaging 0.99
IGL02638:Lrba APN 3 86,232,380 (GRCm39) missense probably damaging 0.97
IGL02647:Lrba APN 3 86,267,038 (GRCm39) missense probably benign 0.00
IGL02664:Lrba APN 3 86,233,038 (GRCm39) missense possibly damaging 0.84
IGL02728:Lrba APN 3 86,683,356 (GRCm39) missense probably damaging 0.99
IGL02730:Lrba APN 3 86,235,506 (GRCm39) missense probably damaging 1.00
IGL02883:Lrba APN 3 86,352,720 (GRCm39) missense probably damaging 0.99
IGL02883:Lrba APN 3 86,261,513 (GRCm39) missense probably damaging 1.00
IGL02948:Lrba APN 3 86,217,691 (GRCm39) splice site probably null
IGL03090:Lrba APN 3 86,680,448 (GRCm39) missense probably benign 0.01
molasses UTSW 3 86,261,614 (GRCm39) critical splice donor site probably null
oscar UTSW 3 86,257,611 (GRCm39) nonsense probably null
oscar2 UTSW 3 86,571,765 (GRCm39) nonsense probably null
P0023:Lrba UTSW 3 86,325,242 (GRCm39) missense probably damaging 1.00
PIT4802001:Lrba UTSW 3 86,571,801 (GRCm39) nonsense probably null
R0077:Lrba UTSW 3 86,449,995 (GRCm39) missense probably damaging 0.99
R0189:Lrba UTSW 3 86,275,816 (GRCm39) missense probably damaging 1.00
R0217:Lrba UTSW 3 86,550,029 (GRCm39) missense probably damaging 1.00
R0349:Lrba UTSW 3 86,447,312 (GRCm39) missense probably damaging 1.00
R0396:Lrba UTSW 3 86,202,486 (GRCm39) missense probably damaging 1.00
R0417:Lrba UTSW 3 86,622,961 (GRCm39) missense probably damaging 1.00
R0536:Lrba UTSW 3 86,622,839 (GRCm39) missense probably damaging 1.00
R0712:Lrba UTSW 3 86,205,297 (GRCm39) nonsense probably null
R0722:Lrba UTSW 3 86,513,296 (GRCm39) critical splice donor site probably null
R0828:Lrba UTSW 3 86,515,677 (GRCm39) splice site probably null
R0927:Lrba UTSW 3 86,687,540 (GRCm39) missense probably damaging 1.00
R1120:Lrba UTSW 3 86,202,499 (GRCm39) missense probably damaging 1.00
R1141:Lrba UTSW 3 86,526,865 (GRCm39) missense probably damaging 1.00
R1276:Lrba UTSW 3 86,571,833 (GRCm39) missense probably damaging 1.00
R1449:Lrba UTSW 3 86,261,585 (GRCm39) missense probably damaging 1.00
R1470:Lrba UTSW 3 86,644,449 (GRCm39) missense probably damaging 1.00
R1470:Lrba UTSW 3 86,644,449 (GRCm39) missense probably damaging 1.00
R1474:Lrba UTSW 3 86,687,573 (GRCm39) splice site probably benign
R1558:Lrba UTSW 3 86,258,622 (GRCm39) missense probably damaging 1.00
R1596:Lrba UTSW 3 86,257,611 (GRCm39) nonsense probably null
R1652:Lrba UTSW 3 86,447,245 (GRCm39) missense probably damaging 1.00
R1800:Lrba UTSW 3 86,259,175 (GRCm39) missense probably benign 0.00
R1819:Lrba UTSW 3 86,449,941 (GRCm39) missense possibly damaging 0.80
R1862:Lrba UTSW 3 86,680,510 (GRCm39) critical splice donor site probably null
R1917:Lrba UTSW 3 86,571,808 (GRCm39) missense probably damaging 1.00
R1965:Lrba UTSW 3 86,513,175 (GRCm39) critical splice acceptor site probably null
R1966:Lrba UTSW 3 86,513,175 (GRCm39) critical splice acceptor site probably null
R1969:Lrba UTSW 3 86,515,696 (GRCm39) missense probably damaging 0.99
R2011:Lrba UTSW 3 86,217,324 (GRCm39) missense probably damaging 0.99
R2179:Lrba UTSW 3 86,261,588 (GRCm39) missense probably damaging 1.00
R2186:Lrba UTSW 3 86,211,643 (GRCm39) missense probably damaging 1.00
R2281:Lrba UTSW 3 86,683,410 (GRCm39) missense possibly damaging 0.46
R2359:Lrba UTSW 3 86,256,057 (GRCm39) missense probably benign 0.01
R2412:Lrba UTSW 3 86,235,007 (GRCm39) missense probably damaging 1.00
R2496:Lrba UTSW 3 86,439,394 (GRCm39) missense probably damaging 1.00
R3153:Lrba UTSW 3 86,192,526 (GRCm39) missense probably damaging 0.99
R3708:Lrba UTSW 3 86,192,331 (GRCm39) missense possibly damaging 0.80
R3746:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3747:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3748:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3749:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3750:Lrba UTSW 3 86,283,260 (GRCm39) missense probably damaging 1.00
R3758:Lrba UTSW 3 86,683,356 (GRCm39) missense probably damaging 0.99
R3975:Lrba UTSW 3 86,258,562 (GRCm39) missense probably damaging 1.00
R4210:Lrba UTSW 3 86,267,433 (GRCm39) missense probably damaging 1.00
R4258:Lrba UTSW 3 86,352,656 (GRCm39) missense probably damaging 1.00
R4657:Lrba UTSW 3 86,644,471 (GRCm39) missense probably damaging 1.00
R4713:Lrba UTSW 3 86,267,175 (GRCm39) missense probably benign 0.13
R4716:Lrba UTSW 3 86,550,021 (GRCm39) missense probably damaging 0.99
R4811:Lrba UTSW 3 86,683,448 (GRCm39) missense probably damaging 1.00
R4827:Lrba UTSW 3 86,267,457 (GRCm39) missense possibly damaging 0.85
R4840:Lrba UTSW 3 86,526,816 (GRCm39) critical splice acceptor site probably null
R4920:Lrba UTSW 3 86,571,765 (GRCm39) nonsense probably null
R4948:Lrba UTSW 3 86,192,335 (GRCm39) missense probably damaging 1.00
R4970:Lrba UTSW 3 86,132,678 (GRCm39) missense probably benign 0.23
R4985:Lrba UTSW 3 86,234,743 (GRCm39) splice site probably null
R4993:Lrba UTSW 3 86,267,344 (GRCm39) missense probably damaging 1.00
R5107:Lrba UTSW 3 86,267,086 (GRCm39) missense possibly damaging 0.47
R5112:Lrba UTSW 3 86,132,678 (GRCm39) missense probably benign 0.23
R5122:Lrba UTSW 3 86,256,461 (GRCm39) nonsense probably null
R5155:Lrba UTSW 3 86,258,607 (GRCm39) missense probably benign 0.25
R5194:Lrba UTSW 3 86,235,526 (GRCm39) missense probably damaging 1.00
R5280:Lrba UTSW 3 86,232,329 (GRCm39) missense possibly damaging 0.94
R5445:Lrba UTSW 3 86,275,902 (GRCm39) missense probably benign
R5469:Lrba UTSW 3 86,449,948 (GRCm39) missense probably damaging 1.00
R5513:Lrba UTSW 3 86,449,948 (GRCm39) missense probably damaging 1.00
R5578:Lrba UTSW 3 86,664,814 (GRCm39) missense probably benign 0.27
R5740:Lrba UTSW 3 86,235,649 (GRCm39) missense probably damaging 1.00
R5868:Lrba UTSW 3 86,226,911 (GRCm39) missense probably damaging 1.00
R6104:Lrba UTSW 3 86,261,099 (GRCm39) missense probably damaging 1.00
R6166:Lrba UTSW 3 86,261,614 (GRCm39) critical splice donor site probably null
R6279:Lrba UTSW 3 86,256,171 (GRCm39) missense probably benign 0.26
R6330:Lrba UTSW 3 86,255,664 (GRCm39) missense probably benign 0.07
R6367:Lrba UTSW 3 86,275,869 (GRCm39) missense probably benign 0.42
R6571:Lrba UTSW 3 86,267,367 (GRCm39) missense probably damaging 1.00
R6584:Lrba UTSW 3 86,571,883 (GRCm39) missense probably damaging 1.00
R6698:Lrba UTSW 3 86,211,732 (GRCm39) missense probably damaging 0.99
R6763:Lrba UTSW 3 86,261,570 (GRCm39) missense probably damaging 1.00
R6834:Lrba UTSW 3 86,257,593 (GRCm39) missense probably benign 0.00
R6951:Lrba UTSW 3 86,653,180 (GRCm39) missense probably benign 0.01
R6969:Lrba UTSW 3 86,526,897 (GRCm39) missense probably benign 0.21
R7045:Lrba UTSW 3 86,192,398 (GRCm39) missense probably benign 0.03
R7133:Lrba UTSW 3 86,302,238 (GRCm39) splice site probably null
R7182:Lrba UTSW 3 86,648,765 (GRCm39) frame shift probably null
R7214:Lrba UTSW 3 86,235,633 (GRCm39) missense probably damaging 1.00
R7224:Lrba UTSW 3 86,302,553 (GRCm39) missense probably damaging 1.00
R7243:Lrba UTSW 3 86,658,823 (GRCm39) splice site probably null
R7350:Lrba UTSW 3 86,259,209 (GRCm39) missense probably damaging 0.96
R7380:Lrba UTSW 3 86,232,381 (GRCm39) missense probably damaging 1.00
R7492:Lrba UTSW 3 86,571,835 (GRCm39) missense probably damaging 1.00
R7651:Lrba UTSW 3 86,648,773 (GRCm39) nonsense probably null
R7754:Lrba UTSW 3 86,352,704 (GRCm39) missense probably damaging 1.00
R7762:Lrba UTSW 3 86,439,508 (GRCm39) missense probably damaging 0.99
R7855:Lrba UTSW 3 86,222,737 (GRCm39) missense possibly damaging 0.94
R7867:Lrba UTSW 3 86,275,896 (GRCm39) missense probably damaging 1.00
R7912:Lrba UTSW 3 86,622,872 (GRCm39) missense probably damaging 1.00
R7995:Lrba UTSW 3 86,526,858 (GRCm39) missense probably damaging 1.00
R8013:Lrba UTSW 3 86,325,278 (GRCm39) missense probably damaging 1.00
R8014:Lrba UTSW 3 86,325,278 (GRCm39) missense probably damaging 1.00
R8024:Lrba UTSW 3 86,202,708 (GRCm39) nonsense probably null
R8027:Lrba UTSW 3 86,325,219 (GRCm39) missense probably benign 0.05
R8090:Lrba UTSW 3 86,255,796 (GRCm39) missense probably benign
R8111:Lrba UTSW 3 86,235,012 (GRCm39) missense probably damaging 1.00
R8118:Lrba UTSW 3 86,261,533 (GRCm39) missense probably benign
R8204:Lrba UTSW 3 86,222,710 (GRCm39) missense possibly damaging 0.95
R8239:Lrba UTSW 3 86,449,882 (GRCm39) missense probably damaging 1.00
R8509:Lrba UTSW 3 86,255,483 (GRCm39) missense probably benign 0.04
R8532:Lrba UTSW 3 86,664,790 (GRCm39) missense probably damaging 1.00
R8726:Lrba UTSW 3 86,261,062 (GRCm39) missense probably benign
R8744:Lrba UTSW 3 86,211,640 (GRCm39) missense probably benign 0.08
R8782:Lrba UTSW 3 86,549,976 (GRCm39) missense probably benign 0.00
R8784:Lrba UTSW 3 86,283,235 (GRCm39) missense probably damaging 1.00
R8922:Lrba UTSW 3 86,263,973 (GRCm39) missense probably damaging 1.00
R8964:Lrba UTSW 3 86,258,552 (GRCm39) missense probably benign 0.22
R8971:Lrba UTSW 3 86,522,388 (GRCm39) missense probably benign 0.00
R9046:Lrba UTSW 3 86,302,543 (GRCm39) missense possibly damaging 0.94
R9155:Lrba UTSW 3 86,202,508 (GRCm39) missense probably damaging 1.00
R9236:Lrba UTSW 3 86,261,066 (GRCm39) missense probably benign 0.05
R9266:Lrba UTSW 3 86,198,774 (GRCm39) missense probably benign 0.08
R9297:Lrba UTSW 3 86,280,873 (GRCm39) missense probably damaging 1.00
R9404:Lrba UTSW 3 86,205,224 (GRCm39) missense probably damaging 0.99
R9617:Lrba UTSW 3 86,267,169 (GRCm39) missense probably benign
R9640:Lrba UTSW 3 86,526,875 (GRCm39) nonsense probably null
R9779:Lrba UTSW 3 86,233,078 (GRCm39) missense probably damaging 1.00
X0065:Lrba UTSW 3 86,232,396 (GRCm39) missense possibly damaging 0.95
X0065:Lrba UTSW 3 86,205,206 (GRCm39) missense probably damaging 1.00
Z1176:Lrba UTSW 3 86,658,839 (GRCm39) missense possibly damaging 0.85
Z1176:Lrba UTSW 3 86,622,845 (GRCm39) missense probably benign 0.31
Z1177:Lrba UTSW 3 86,447,356 (GRCm39) missense probably null 1.00
Predicted Primers PCR Primer
(F):5'- CTATGCTTCTCTTACGCAAATGG -3'
(R):5'- TGTAGCACATGGGCAAGAAC -3'

Sequencing Primer
(F):5'- GCTTCTCTTACGCAAATGGAAAAGC -3'
(R):5'- GCAAGCAGAGACCATATTT -3'
Posted On 2019-11-12