Incidental Mutation 'R7729:Ddx58'
ID595688
Institutional Source Beutler Lab
Gene Symbol Ddx58
Ensembl Gene ENSMUSG00000040296
Gene NameDEAD (Asp-Glu-Ala-Asp) box polypeptide 58
SynonymsRIG-I, 6430573D20Rik
Accession Numbers

Genbank: NM_172689; MGI:2442858

Is this an essential gene? Probably non essential (E-score: 0.196) question?
Stock #R7729 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location40203773-40239828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 40206034 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Phenylalanine at position 853 (I853F)
Ref Sequence ENSEMBL: ENSMUSP00000042433 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037907] [ENSMUST00000142055]
PDB Structure
Mouse RIG-I ATPase Domain [X-RAY DIFFRACTION]
Predicted Effect possibly damaging
Transcript: ENSMUST00000037907
AA Change: I853F

PolyPhen 2 Score 0.530 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000042433
Gene: ENSMUSG00000040296
AA Change: I853F

DomainStartEndE-ValueType
Pfam:CARD_2 1 93 1.2e-31 PFAM
Pfam:CARD_2 99 189 6.2e-28 PFAM
DEXDc 240 453 8.61e-26 SMART
low complexity region 582 600 N/A INTRINSIC
HELICc 642 735 1.32e-12 SMART
Pfam:RIG-I_C-RD 807 924 4.4e-39 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000142055
SMART Domains Protein: ENSMUSP00000115052
Gene: ENSMUSG00000040296

DomainStartEndE-ValueType
PDB:4NQK|D 1 153 3e-53 PDB
DEXDc 195 408 8.61e-26 SMART
low complexity region 537 555 N/A INTRINSIC
HELICc 597 690 1.32e-12 SMART
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] DEAD box proteins, characterized by the conserved motif Asp-Glu-Ala-Asp (DEAD), are putative RNA helicases which are implicated in a number of cellular processes involving RNA binding and alteration of RNA secondary structure. This gene encodes a protein containing RNA helicase-DEAD box protein motifs and a caspase recruitment domain (CARD). It is involved in viral double-stranded (ds) RNA recognition and the regulation of immune response. [provided by RefSeq, Jul 2008]
PHENOTYPE: Most homozygotes for a null allele die in utero with liver apoptosis while survivors show impaired IFN induction and succumb to infection with certain RNA viruses. Homozygotes for another null allele are viable but develop colitis and progressive granulocytosis leading to chronic myeloid leukemia. [provided by MGI curators]
Allele List at MGI

All alleles(9) : Targeted, knock-out(2) Gene trapped(7)

Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Adgrb2 C T 4: 129,992,124 T19M probably benign Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Dock7 G A 4: 99,055,446 P520S Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Eprs T A 1: 185,413,169 Y1130N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Gata4 C A 14: 63,240,737 A138S probably benign Het
Golga4 A G 9: 118,556,063 H751R possibly damaging Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rcor3 A G 1: 192,101,778 Y387H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slc35d1 C T 4: 103,214,847 R7H probably damaging Het
Slco6d1 A T 1: 98,497,523 T599S probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgfb2 C A 1: 186,630,757 G290V possibly damaging Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Ddx58
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00662:Ddx58 APN 4 40220389 splice site probably benign
IGL01344:Ddx58 APN 4 40208883 missense probably damaging 0.99
IGL01414:Ddx58 APN 4 40222176 missense probably damaging 1.00
IGL01529:Ddx58 APN 4 40225685 missense probably benign
IGL01756:Ddx58 APN 4 40209934 missense probably damaging 1.00
IGL02023:Ddx58 APN 4 40216487 missense possibly damaging 0.76
IGL02223:Ddx58 APN 4 40209993 missense possibly damaging 0.48
IGL02458:Ddx58 APN 4 40229536 missense probably damaging 0.98
IGL02937:Ddx58 APN 4 40229661 missense probably benign 0.00
IGL03358:Ddx58 APN 4 40206069 missense possibly damaging 0.54
E2594:Ddx58 UTSW 4 40235282 nonsense probably null
R0324:Ddx58 UTSW 4 40213766 missense probably benign 0.24
R0400:Ddx58 UTSW 4 40235257 missense probably benign 0.00
R0518:Ddx58 UTSW 4 40216354 critical splice donor site probably null
R0834:Ddx58 UTSW 4 40239596 missense possibly damaging 0.64
R1474:Ddx58 UTSW 4 40208868 missense possibly damaging 0.62
R1611:Ddx58 UTSW 4 40223862 missense probably damaging 1.00
R1803:Ddx58 UTSW 4 40224013 missense probably benign 0.00
R1906:Ddx58 UTSW 4 40206054 missense probably benign 0.01
R2072:Ddx58 UTSW 4 40224069 splice site probably null
R4696:Ddx58 UTSW 4 40203798 unclassified probably benign
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R4860:Ddx58 UTSW 4 40210000 missense probably damaging 0.97
R5027:Ddx58 UTSW 4 40208845 missense probably benign
R5568:Ddx58 UTSW 4 40222140 missense probably benign
R6144:Ddx58 UTSW 4 40229551 missense probably benign 0.21
R6341:Ddx58 UTSW 4 40222199 critical splice acceptor site probably null
R6373:Ddx58 UTSW 4 40216487 missense possibly damaging 0.76
R6454:Ddx58 UTSW 4 40220456 missense probably damaging 0.99
R6456:Ddx58 UTSW 4 40213838 missense possibly damaging 0.73
R6523:Ddx58 UTSW 4 40205947 missense probably benign 0.00
R6593:Ddx58 UTSW 4 40226651 missense probably benign 0.02
R6741:Ddx58 UTSW 4 40211624 missense probably damaging 1.00
R6964:Ddx58 UTSW 4 40225697 missense probably benign 0.00
R7149:Ddx58 UTSW 4 40222079 missense possibly damaging 0.64
R7159:Ddx58 UTSW 4 40213804 missense probably benign 0.29
R7237:Ddx58 UTSW 4 40205938 missense probably benign 0.10
R7352:Ddx58 UTSW 4 40239668 missense probably benign 0.00
R7356:Ddx58 UTSW 4 40226600 missense probably benign 0.01
R7611:Ddx58 UTSW 4 40225651 missense probably damaging 1.00
R7615:Ddx58 UTSW 4 40229653 missense possibly damaging 0.59
R7759:Ddx58 UTSW 4 40225104 missense probably damaging 1.00
R7800:Ddx58 UTSW 4 40211618 missense probably benign 0.35
Predicted Primers PCR Primer
(F):5'- AGAAGCCTGAGGTCATACGG -3'
(R):5'- GGATCCCACTCATTCCTGAC -3'

Sequencing Primer
(F):5'- ACGGACATTTCTGCAGGATC -3'
(R):5'- CCTGACTTTTAGCTACTGAGTGGC -3'
Posted On2019-11-12