Incidental Mutation 'R7729:Dock7'
ID 595689
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Name dedicator of cytokinesis 7
Synonyms m, LOC242555, 3110056M06Rik
MMRRC Submission 045785-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R7729 (G1)
Quality Score 225.009
Status Not validated
Chromosome 4
Chromosomal Location 98824908-99009152 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) G to A at 98943683 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Proline to Serine at position 520 (P520S)
Ref Sequence ENSEMBL: ENSMUSP00000117797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000030286
AA Change: P520S

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: P520S

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: P520S

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: P520S

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect probably damaging
Transcript: ENSMUST00000205650
AA Change: P520S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1810024B03Rik T G 2: 127,028,710 (GRCm39) D163A possibly damaging Het
Abce1 A T 8: 80,414,537 (GRCm39) I454N probably damaging Het
Acaca A G 11: 84,262,339 (GRCm39) I1980M probably damaging Het
Adgrb2 C T 4: 129,885,917 (GRCm39) T19M probably benign Het
Agmo T A 12: 37,464,974 (GRCm39) S417T probably benign Het
Akap8l T C 17: 32,552,068 (GRCm39) E403G probably damaging Het
Art5 C T 7: 101,747,711 (GRCm39) A23T possibly damaging Het
Atg9a T C 1: 75,161,204 (GRCm39) T681A probably benign Het
Atp11b A G 3: 35,832,256 (GRCm39) Q37R probably damaging Het
Atp2a2 T C 5: 122,629,829 (GRCm39) E80G probably benign Het
AW551984 G A 9: 39,511,071 (GRCm39) P172L possibly damaging Het
Bace1 C T 9: 45,769,743 (GRCm39) R296C probably damaging Het
Ccser1 T A 6: 61,288,840 (GRCm39) H334Q probably benign Het
Chtf18 C T 17: 25,942,491 (GRCm39) R449H probably damaging Het
Cit A G 5: 116,122,881 (GRCm39) H1384R possibly damaging Het
Cltc A G 11: 86,612,474 (GRCm39) I524T probably benign Het
Dctn1 T A 6: 83,160,042 (GRCm39) I94N probably damaging Het
Dnhd1 A T 7: 105,354,472 (GRCm39) D3078V probably damaging Het
Epb41l4a C A 18: 33,987,326 (GRCm39) K350N probably damaging Het
Eprs1 T A 1: 185,145,366 (GRCm39) Y1130N probably damaging Het
Fcgrt T C 7: 44,744,797 (GRCm39) T224A probably damaging Het
Flt1 T A 5: 147,637,177 (GRCm39) T39S probably benign Het
Fxyd1 T C 7: 30,752,896 (GRCm39) Y33C probably damaging Het
Gab2 T A 7: 96,950,633 (GRCm39) V442E probably damaging Het
Ganab A G 19: 8,892,076 (GRCm39) D800G probably benign Het
Gata4 C A 14: 63,478,186 (GRCm39) A138S probably benign Het
Golga4 A G 9: 118,385,131 (GRCm39) H751R possibly damaging Het
H1f6 A G 13: 23,880,455 (GRCm39) R203G possibly damaging Het
Htra4 A G 8: 25,527,093 (GRCm39) V234A possibly damaging Het
Igkv4-74 A T 6: 69,161,954 (GRCm39) Y72N probably damaging Het
Iqsec3 T C 6: 121,360,940 (GRCm39) K973E probably damaging Het
Khdc1b C A 1: 21,455,065 (GRCm39) T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 141,850,333 (GRCm39) probably benign Het
Kyat3 A G 3: 142,432,066 (GRCm39) probably null Het
Lrba T A 3: 86,225,474 (GRCm39) V666E probably damaging Het
Mettl25 T A 10: 105,601,871 (GRCm39) Y528F probably benign Het
Mms19 A T 19: 41,940,904 (GRCm39) Y619* probably null Het
Nlrp12 A C 7: 3,277,020 (GRCm39) probably null Het
Nol10 C T 12: 17,474,676 (GRCm39) L623F possibly damaging Het
Oas1g A G 5: 121,024,063 (GRCm39) F82S probably damaging Het
Or1j8 T G 2: 36,191,772 (GRCm39) S74A probably benign Het
Or5k3 C T 16: 58,969,570 (GRCm39) A119V probably damaging Het
Or8g18 G A 9: 39,149,546 (GRCm39) P58L probably benign Het
Oxr1 G A 15: 41,686,863 (GRCm39) E582K probably damaging Het
Pdia3 A G 2: 121,262,838 (GRCm39) D268G possibly damaging Het
Pramel13 T C 4: 144,119,434 (GRCm39) S378G probably damaging Het
Rcor3 A G 1: 191,786,078 (GRCm39) Y387H probably damaging Het
Rigi T A 4: 40,206,034 (GRCm39) I853F possibly damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,229,118 (GRCm39) probably benign Het
Rsl1 T C 13: 67,330,284 (GRCm39) L244P possibly damaging Het
Scn5a G T 9: 119,324,606 (GRCm39) N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 (GRCm39) A24V probably benign Het
Slc22a8 A G 19: 8,571,323 (GRCm39) Y18C possibly damaging Het
Slc35d1 C T 4: 103,072,044 (GRCm39) R7H probably damaging Het
Slco6d1 A T 1: 98,425,248 (GRCm39) T599S probably damaging Het
Spata31d1e C T 13: 59,889,437 (GRCm39) M794I not run Het
St18 T A 1: 6,872,761 (GRCm39) H165Q probably benign Het
Sub1 C T 15: 11,986,589 (GRCm39) R86K probably damaging Het
Tectb G A 19: 55,181,104 (GRCm39) V148M Het
Tgfb2 C A 1: 186,362,954 (GRCm39) G290V possibly damaging Het
Tgm7 T C 2: 120,924,191 (GRCm39) H577R probably benign Het
Tle2 T C 10: 81,422,981 (GRCm39) S460P probably damaging Het
Tmem221 C A 8: 72,011,446 (GRCm39) R3L possibly damaging Het
Tnfrsf19 C A 14: 61,212,183 (GRCm39) V156L possibly damaging Het
Trav6-5 A G 14: 53,728,964 (GRCm39) K75E probably benign Het
Trip10 G A 17: 57,569,442 (GRCm39) G488S probably damaging Het
Usp34 A C 11: 23,399,268 (GRCm39) K2419T Het
Vps13d T C 4: 144,801,622 (GRCm39) Q3532R Het
Vps4a A T 8: 107,767,529 (GRCm39) I163L probably damaging Het
Wrn T C 8: 33,814,454 (GRCm39) H330R probably benign Het
Xpr1 T C 1: 155,188,618 (GRCm39) I341V probably benign Het
Zfyve9 T C 4: 108,548,973 (GRCm39) E105G probably benign Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 98,952,222 (GRCm39) missense probably damaging 1.00
IGL01126:Dock7 APN 4 98,861,789 (GRCm39) splice site probably benign
IGL01490:Dock7 APN 4 98,833,355 (GRCm39) unclassified probably benign
IGL01553:Dock7 APN 4 98,833,803 (GRCm39) nonsense probably null
IGL01728:Dock7 APN 4 98,850,568 (GRCm39) missense probably damaging 1.00
IGL01776:Dock7 APN 4 98,829,178 (GRCm39) missense possibly damaging 0.65
IGL01954:Dock7 APN 4 98,971,388 (GRCm39) missense probably damaging 0.99
IGL01985:Dock7 APN 4 98,911,614 (GRCm39) missense probably benign 0.35
IGL02054:Dock7 APN 4 98,861,646 (GRCm39) missense probably damaging 1.00
IGL02150:Dock7 APN 4 98,968,089 (GRCm39) splice site probably benign
IGL02153:Dock7 APN 4 98,846,304 (GRCm39) missense probably benign 0.15
IGL02183:Dock7 APN 4 98,847,228 (GRCm39) missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98,877,471 (GRCm39) missense probably benign 0.18
IGL02618:Dock7 APN 4 98,971,265 (GRCm39) missense probably benign 0.00
IGL02634:Dock7 APN 4 98,877,533 (GRCm39) missense probably damaging 1.00
IGL02670:Dock7 APN 4 98,854,523 (GRCm39) splice site probably null
IGL02690:Dock7 APN 4 98,857,872 (GRCm39) missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98,875,623 (GRCm39) missense probably damaging 1.00
IGL02833:Dock7 APN 4 98,833,732 (GRCm39) missense probably damaging 1.00
IGL02858:Dock7 APN 4 98,833,442 (GRCm39) nonsense probably null
IGL02875:Dock7 APN 4 98,864,231 (GRCm39) missense probably benign 0.00
IGL03027:Dock7 APN 4 98,958,450 (GRCm39) missense possibly damaging 0.71
IGL03027:Dock7 APN 4 98,866,164 (GRCm39) missense probably benign
IGL03032:Dock7 APN 4 98,854,585 (GRCm39) missense probably benign 0.02
IGL03104:Dock7 APN 4 98,847,260 (GRCm39) missense possibly damaging 0.60
IGL03136:Dock7 APN 4 98,892,028 (GRCm39) missense probably damaging 1.00
IGL03345:Dock7 APN 4 98,873,056 (GRCm39) missense possibly damaging 0.91
Beaming UTSW 4 98,967,992 (GRCm39) nonsense probably null
moonlight UTSW 4 0 () large deletion
Nocturn UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
sonata UTSW 4 98,889,364 (GRCm39) nonsense probably null
BB005:Dock7 UTSW 4 98,889,335 (GRCm39) missense
BB015:Dock7 UTSW 4 98,889,335 (GRCm39) missense
PIT4810001:Dock7 UTSW 4 98,833,796 (GRCm39) nonsense probably null
R0086:Dock7 UTSW 4 98,833,381 (GRCm39) missense probably damaging 1.00
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0242:Dock7 UTSW 4 98,850,517 (GRCm39) missense probably benign
R0245:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98,873,051 (GRCm39) missense probably benign 0.07
R0556:Dock7 UTSW 4 98,833,426 (GRCm39) missense probably damaging 1.00
R0612:Dock7 UTSW 4 98,877,470 (GRCm39) missense probably benign 0.31
R0652:Dock7 UTSW 4 98,943,586 (GRCm39) missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98,875,716 (GRCm39) missense probably benign 0.00
R0681:Dock7 UTSW 4 98,904,941 (GRCm39) missense probably damaging 1.00
R0725:Dock7 UTSW 4 98,833,528 (GRCm39) missense probably damaging 1.00
R0828:Dock7 UTSW 4 98,903,982 (GRCm39) missense probably damaging 1.00
R0837:Dock7 UTSW 4 98,877,495 (GRCm39) missense probably benign 0.01
R0962:Dock7 UTSW 4 98,833,432 (GRCm39) missense possibly damaging 0.85
R1140:Dock7 UTSW 4 98,953,643 (GRCm39) missense possibly damaging 0.82
R1476:Dock7 UTSW 4 98,967,672 (GRCm39) missense possibly damaging 0.52
R1614:Dock7 UTSW 4 98,949,517 (GRCm39) missense probably benign 0.12
R1625:Dock7 UTSW 4 98,850,433 (GRCm39) splice site probably null
R1640:Dock7 UTSW 4 98,833,483 (GRCm39) missense probably damaging 1.00
R1752:Dock7 UTSW 4 98,854,681 (GRCm39) missense probably damaging 1.00
R1941:Dock7 UTSW 4 98,872,952 (GRCm39) missense probably benign 0.09
R2020:Dock7 UTSW 4 98,847,338 (GRCm39) missense probably damaging 1.00
R2092:Dock7 UTSW 4 98,897,545 (GRCm39) missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98,854,606 (GRCm39) missense probably damaging 1.00
R2424:Dock7 UTSW 4 98,833,544 (GRCm39) nonsense probably null
R3767:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3768:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3769:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3770:Dock7 UTSW 4 98,859,066 (GRCm39) missense probably benign
R3917:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R3943:Dock7 UTSW 4 98,880,668 (GRCm39) missense probably damaging 1.00
R4021:Dock7 UTSW 4 98,892,157 (GRCm39) splice site probably null
R4073:Dock7 UTSW 4 98,896,296 (GRCm39) missense probably benign 0.02
R4170:Dock7 UTSW 4 98,854,638 (GRCm39) missense probably damaging 0.99
R4180:Dock7 UTSW 4 98,904,973 (GRCm39) missense probably benign 0.05
R4261:Dock7 UTSW 4 98,892,123 (GRCm39) missense possibly damaging 0.78
R4321:Dock7 UTSW 4 98,960,691 (GRCm39) missense probably damaging 1.00
R4522:Dock7 UTSW 4 98,850,461 (GRCm39) missense probably damaging 1.00
R4582:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98,857,881 (GRCm39) nonsense probably null
R4940:Dock7 UTSW 4 98,908,314 (GRCm39) missense probably damaging 1.00
R5090:Dock7 UTSW 4 98,879,648 (GRCm39) missense probably benign 0.04
R5374:Dock7 UTSW 4 98,877,275 (GRCm39) missense possibly damaging 0.81
R5392:Dock7 UTSW 4 98,896,243 (GRCm39) missense probably damaging 1.00
R5527:Dock7 UTSW 4 98,842,105 (GRCm39) intron probably benign
R5544:Dock7 UTSW 4 98,855,494 (GRCm39) missense probably damaging 1.00
R5556:Dock7 UTSW 4 98,832,972 (GRCm39) missense probably damaging 1.00
R5870:Dock7 UTSW 4 98,952,199 (GRCm39) missense probably benign 0.00
R5899:Dock7 UTSW 4 98,879,660 (GRCm39) missense probably benign
R6360:Dock7 UTSW 4 98,857,899 (GRCm39) missense probably benign 0.02
R6415:Dock7 UTSW 4 98,880,685 (GRCm39) missense probably damaging 1.00
R6468:Dock7 UTSW 4 98,855,464 (GRCm39) missense probably benign 0.15
R6562:Dock7 UTSW 4 98,879,647 (GRCm39) missense probably damaging 0.97
R6613:Dock7 UTSW 4 98,866,197 (GRCm39) missense probably damaging 0.99
R6703:Dock7 UTSW 4 98,834,909 (GRCm39) missense probably damaging 1.00
R6723:Dock7 UTSW 4 98,892,153 (GRCm39) missense possibly damaging 0.90
R6786:Dock7 UTSW 4 98,949,529 (GRCm39) missense probably benign 0.42
R7026:Dock7 UTSW 4 98,967,156 (GRCm39) missense probably benign
R7051:Dock7 UTSW 4 98,834,969 (GRCm39) missense probably damaging 1.00
R7074:Dock7 UTSW 4 98,833,445 (GRCm39) missense unknown
R7106:Dock7 UTSW 4 98,855,563 (GRCm39) missense unknown
R7147:Dock7 UTSW 4 98,849,654 (GRCm39) missense unknown
R7257:Dock7 UTSW 4 98,861,649 (GRCm39) missense unknown
R7334:Dock7 UTSW 4 98,864,180 (GRCm39) missense unknown
R7511:Dock7 UTSW 4 98,967,992 (GRCm39) nonsense probably null
R7511:Dock7 UTSW 4 98,949,519 (GRCm39) missense
R7928:Dock7 UTSW 4 98,889,335 (GRCm39) missense
R7984:Dock7 UTSW 4 98,877,303 (GRCm39) missense unknown
R8287:Dock7 UTSW 4 98,866,157 (GRCm39) missense unknown
R8439:Dock7 UTSW 4 98,971,266 (GRCm39) missense
R8466:Dock7 UTSW 4 98,952,336 (GRCm39) missense possibly damaging 0.70
R8758:Dock7 UTSW 4 98,949,555 (GRCm39) missense
R8849:Dock7 UTSW 4 98,904,986 (GRCm39) missense
R8944:Dock7 UTSW 4 98,829,243 (GRCm39) missense probably damaging 1.00
R8964:Dock7 UTSW 4 98,949,476 (GRCm39) missense
R9008:Dock7 UTSW 4 98,833,448 (GRCm39) nonsense probably null
R9040:Dock7 UTSW 4 98,889,364 (GRCm39) nonsense probably null
R9160:Dock7 UTSW 4 98,857,962 (GRCm39) missense unknown
R9168:Dock7 UTSW 4 98,953,643 (GRCm39) missense
R9189:Dock7 UTSW 4 98,877,350 (GRCm39) missense unknown
R9215:Dock7 UTSW 4 98,859,088 (GRCm39) missense unknown
R9243:Dock7 UTSW 4 98,857,871 (GRCm39) missense unknown
R9256:Dock7 UTSW 4 98,971,272 (GRCm39) missense
R9328:Dock7 UTSW 4 98,968,064 (GRCm39) missense
R9332:Dock7 UTSW 4 98,896,280 (GRCm39) missense
R9450:Dock7 UTSW 4 98,861,426 (GRCm39) missense unknown
R9584:Dock7 UTSW 4 98,861,481 (GRCm39) nonsense probably null
R9631:Dock7 UTSW 4 98,854,560 (GRCm39) missense unknown
R9676:Dock7 UTSW 4 98,904,922 (GRCm39) missense probably damaging 1.00
R9701:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
R9723:Dock7 UTSW 4 98,960,660 (GRCm39) missense
R9723:Dock7 UTSW 4 98,908,270 (GRCm39) missense
R9727:Dock7 UTSW 4 98,875,568 (GRCm39) missense unknown
R9777:Dock7 UTSW 4 98,877,464 (GRCm39) missense unknown
R9802:Dock7 UTSW 4 98,846,384 (GRCm39) missense unknown
X0027:Dock7 UTSW 4 98,892,090 (GRCm39) missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98,833,462 (GRCm39) missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCACATAGGTAGAGCTTATTATGC -3'
(R):5'- GTGACAGACTACCTCACAGGAG -3'

Sequencing Primer
(F):5'- CATCCCTGGCAGGAAATT -3'
(R):5'- CCCATTGTGGAGCAGAACACTTTTG -3'
Posted On 2019-11-12