Incidental Mutation 'R7729:Dock7'
ID595689
Institutional Source Beutler Lab
Gene Symbol Dock7
Ensembl Gene ENSMUSG00000028556
Gene Namededicator of cytokinesis 7
Synonyms3110056M06Rik, m, LOC242555
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R7729 (G1)
Quality Score225.009
Status Not validated
Chromosome4
Chromosomal Location98936671-99120915 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 99055446 bp
ZygosityHeterozygous
Amino Acid Change Proline to Serine at position 520 (P520S)
Ref Sequence ENSEMBL: ENSMUSP00000117797 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030286] [ENSMUST00000075836] [ENSMUST00000127417] [ENSMUST00000205650]
Predicted Effect probably benign
Transcript: ENSMUST00000030286
AA Change: P520S

PolyPhen 2 Score 0.183 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000030286
Gene: ENSMUSG00000028556
AA Change: P520S

DomainStartEndE-ValueType
Pfam:DUF3398 67 159 6.5e-30 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 557 736 1.8e-51 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1135 1163 N/A INTRINSIC
low complexity region 1350 1364 N/A INTRINSIC
low complexity region 1543 1565 N/A INTRINSIC
Pfam:DHR-2 1571 2095 1.4e-217 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000075233
Gene: ENSMUSG00000028556
AA Change: P520S

DomainStartEndE-ValueType
Pfam:DUF3398 65 159 5.8e-34 PFAM
coiled coil region 367 394 N/A INTRINSIC
low complexity region 493 504 N/A INTRINSIC
Pfam:DOCK-C2 556 737 3.3e-58 PFAM
low complexity region 789 799 N/A INTRINSIC
low complexity region 862 873 N/A INTRINSIC
low complexity region 888 901 N/A INTRINSIC
low complexity region 1105 1133 N/A INTRINSIC
low complexity region 1320 1334 N/A INTRINSIC
low complexity region 1513 1535 N/A INTRINSIC
Pfam:Ded_cyto 1888 2065 6.5e-80 PFAM
Predicted Effect
SMART Domains Protein: ENSMUSP00000117797
Gene: ENSMUSG00000028556
AA Change: P520S

DomainStartEndE-ValueType
low complexity region 140 162 N/A INTRINSIC
Pfam:Ded_cyto 517 694 3e-80 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000131386
Predicted Effect probably damaging
Transcript: ENSMUST00000205650
AA Change: P520S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is a guanine nucleotide exchange factor (GEF) that plays a role in axon formation and neuronal polarization. The encoded protein displays GEF activity toward RAC1 and RAC3 Rho small GTPases but not toward CDC42. Several transcript variants encoding different isoforms have been found for this gene. [provided by RefSeq, Dec 2012]
PHENOTYPE: Mice homozygous for mutations of this gene exhibit coat color dilution, white tail tip, and on some genetic backgrounds a white belly spot. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Adgrb2 C T 4: 129,992,124 T19M probably benign Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Ddx58 T A 4: 40,206,034 I853F possibly damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Eprs T A 1: 185,413,169 Y1130N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Gata4 C A 14: 63,240,737 A138S probably benign Het
Golga4 A G 9: 118,556,063 H751R possibly damaging Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rcor3 A G 1: 192,101,778 Y387H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slc35d1 C T 4: 103,214,847 R7H probably damaging Het
Slco6d1 A T 1: 98,497,523 T599S probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgfb2 C A 1: 186,630,757 G290V possibly damaging Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Dock7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00159:Dock7 APN 4 99063985 missense probably damaging 1.00
IGL01126:Dock7 APN 4 98973552 splice site probably benign
IGL01490:Dock7 APN 4 98945118 unclassified probably benign
IGL01553:Dock7 APN 4 98945566 nonsense probably null
IGL01728:Dock7 APN 4 98962331 missense probably damaging 1.00
IGL01776:Dock7 APN 4 98940941 missense possibly damaging 0.65
IGL01954:Dock7 APN 4 99083151 missense probably damaging 0.99
IGL01985:Dock7 APN 4 99023377 missense probably benign 0.35
IGL02054:Dock7 APN 4 98973409 missense probably damaging 1.00
IGL02150:Dock7 APN 4 99079852 splice site probably benign
IGL02153:Dock7 APN 4 98958067 missense probably benign 0.15
IGL02183:Dock7 APN 4 98958991 missense possibly damaging 0.89
IGL02494:Dock7 APN 4 98989234 missense probably benign 0.18
IGL02618:Dock7 APN 4 99083028 missense probably benign 0.00
IGL02634:Dock7 APN 4 98989296 missense probably damaging 1.00
IGL02670:Dock7 APN 4 98966286 splice site probably null
IGL02690:Dock7 APN 4 98969635 missense possibly damaging 0.95
IGL02692:Dock7 APN 4 98987386 missense probably damaging 1.00
IGL02833:Dock7 APN 4 98945495 missense probably damaging 1.00
IGL02858:Dock7 APN 4 98945205 nonsense probably null
IGL02875:Dock7 APN 4 98975994 missense probably benign 0.00
IGL03027:Dock7 APN 4 98977927 missense probably benign
IGL03027:Dock7 APN 4 99070213 missense possibly damaging 0.71
IGL03032:Dock7 APN 4 98966348 missense probably benign 0.02
IGL03104:Dock7 APN 4 98959023 missense possibly damaging 0.60
IGL03136:Dock7 APN 4 99003791 missense probably damaging 1.00
IGL03345:Dock7 APN 4 98984819 missense possibly damaging 0.91
moonlight UTSW 4 large deletion
BB005:Dock7 UTSW 4 99001098 missense
BB015:Dock7 UTSW 4 99001098 missense
PIT4810001:Dock7 UTSW 4 98945559 nonsense probably null
R0086:Dock7 UTSW 4 98945144 missense probably damaging 1.00
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0242:Dock7 UTSW 4 98962280 missense probably benign
R0245:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0308:Dock7 UTSW 4 98984814 missense probably benign 0.07
R0556:Dock7 UTSW 4 98945189 missense probably damaging 1.00
R0612:Dock7 UTSW 4 98989233 missense probably benign 0.31
R0652:Dock7 UTSW 4 99055349 missense possibly damaging 0.64
R0669:Dock7 UTSW 4 98987479 missense probably benign 0.00
R0681:Dock7 UTSW 4 99016704 missense probably damaging 1.00
R0725:Dock7 UTSW 4 98945291 missense probably damaging 1.00
R0828:Dock7 UTSW 4 99015745 missense probably damaging 1.00
R0837:Dock7 UTSW 4 98989258 missense probably benign 0.01
R0962:Dock7 UTSW 4 98945195 missense possibly damaging 0.85
R1140:Dock7 UTSW 4 99065406 missense possibly damaging 0.82
R1476:Dock7 UTSW 4 99079435 missense possibly damaging 0.52
R1614:Dock7 UTSW 4 99061280 missense probably benign 0.12
R1625:Dock7 UTSW 4 98962196 splice site probably null
R1640:Dock7 UTSW 4 98945246 missense probably damaging 1.00
R1752:Dock7 UTSW 4 98966444 missense probably damaging 1.00
R1941:Dock7 UTSW 4 98984715 missense probably benign 0.09
R2020:Dock7 UTSW 4 98959101 missense probably damaging 1.00
R2092:Dock7 UTSW 4 99009308 missense possibly damaging 0.95
R2293:Dock7 UTSW 4 98966369 missense probably damaging 1.00
R2424:Dock7 UTSW 4 98945307 nonsense probably null
R3767:Dock7 UTSW 4 98970829 missense probably benign
R3768:Dock7 UTSW 4 98970829 missense probably benign
R3769:Dock7 UTSW 4 98970829 missense probably benign
R3770:Dock7 UTSW 4 98970829 missense probably benign
R3917:Dock7 UTSW 4 99016685 missense probably damaging 1.00
R3943:Dock7 UTSW 4 98992431 missense probably damaging 1.00
R4021:Dock7 UTSW 4 99003920 splice site probably null
R4073:Dock7 UTSW 4 99008059 missense probably benign 0.02
R4170:Dock7 UTSW 4 98966401 missense probably damaging 0.99
R4180:Dock7 UTSW 4 99016736 missense probably benign 0.05
R4261:Dock7 UTSW 4 99003886 missense possibly damaging 0.78
R4321:Dock7 UTSW 4 99072454 missense probably damaging 1.00
R4522:Dock7 UTSW 4 98962224 missense probably damaging 1.00
R4582:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R4648:Dock7 UTSW 4 98969644 nonsense probably null
R4940:Dock7 UTSW 4 99020077 missense probably damaging 1.00
R5090:Dock7 UTSW 4 98991411 missense probably benign 0.04
R5374:Dock7 UTSW 4 98989038 missense possibly damaging 0.81
R5392:Dock7 UTSW 4 99008006 missense probably damaging 1.00
R5527:Dock7 UTSW 4 98953868 intron probably benign
R5544:Dock7 UTSW 4 98967257 missense probably damaging 1.00
R5556:Dock7 UTSW 4 98944735 missense probably damaging 1.00
R5870:Dock7 UTSW 4 99063962 missense probably benign 0.00
R5899:Dock7 UTSW 4 98991423 missense probably benign
R6360:Dock7 UTSW 4 98969662 missense probably benign 0.02
R6415:Dock7 UTSW 4 98992448 missense probably damaging 1.00
R6468:Dock7 UTSW 4 98967227 missense probably benign 0.15
R6562:Dock7 UTSW 4 98991410 missense probably damaging 0.97
R6613:Dock7 UTSW 4 98977960 missense probably damaging 0.99
R6703:Dock7 UTSW 4 98946672 missense probably damaging 1.00
R6723:Dock7 UTSW 4 99003916 missense possibly damaging 0.90
R6786:Dock7 UTSW 4 99061292 missense probably benign 0.42
R7026:Dock7 UTSW 4 99078919 missense probably benign
R7051:Dock7 UTSW 4 98946732 missense probably damaging 1.00
R7074:Dock7 UTSW 4 98945208 missense unknown
R7106:Dock7 UTSW 4 98967326 missense unknown
R7147:Dock7 UTSW 4 98961417 missense unknown
R7257:Dock7 UTSW 4 98973412 missense unknown
R7334:Dock7 UTSW 4 98975943 missense unknown
R7511:Dock7 UTSW 4 99061282 missense
R7511:Dock7 UTSW 4 99079755 nonsense probably null
R7928:Dock7 UTSW 4 99001098 missense
R7984:Dock7 UTSW 4 98989066 missense unknown
R8287:Dock7 UTSW 4 98977920 missense unknown
R8439:Dock7 UTSW 4 99083029 missense
X0027:Dock7 UTSW 4 99003853 missense probably damaging 0.99
Z1176:Dock7 UTSW 4 98945225 missense unknown
Predicted Primers PCR Primer
(F):5'- CAGCACATAGGTAGAGCTTATTATGC -3'
(R):5'- GTGACAGACTACCTCACAGGAG -3'

Sequencing Primer
(F):5'- CATCCCTGGCAGGAAATT -3'
(R):5'- CCCATTGTGGAGCAGAACACTTTTG -3'
Posted On2019-11-12