Incidental Mutation 'R7729:Slc35d1'
ID595690
Institutional Source Beutler Lab
Gene Symbol Slc35d1
Ensembl Gene ENSMUSG00000028521
Gene Namesolute carrier family 35 (UDP-glucuronic acid/UDP-N-acetylgalactosamine dual transporter), member D1
SynonymsUGTREL7
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R7729 (G1)
Quality Score180.009
Status Not validated
Chromosome4
Chromosomal Location103170649-103215164 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 103214847 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 7 (R7H)
Ref Sequence ENSEMBL: ENSMUSP00000122124 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036195] [ENSMUST00000150285] [ENSMUST00000183432]
Predicted Effect probably benign
Transcript: ENSMUST00000036195
SMART Domains Protein: ENSMUSP00000037617
Gene: ENSMUSG00000028521

DomainStartEndE-ValueType
Pfam:TPT 18 307 6.4e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000150285
AA Change: R7H

PolyPhen 2 Score 0.987 (Sensitivity: 0.73; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000122124
Gene: ENSMUSG00000028521
AA Change: R7H

DomainStartEndE-ValueType
transmembrane domain 37 59 N/A INTRINSIC
transmembrane domain 69 88 N/A INTRINSIC
transmembrane domain 158 177 N/A INTRINSIC
transmembrane domain 187 205 N/A INTRINSIC
transmembrane domain 217 239 N/A INTRINSIC
transmembrane domain 259 281 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000183432
SMART Domains Protein: ENSMUSP00000138926
Gene: ENSMUSG00000028521

DomainStartEndE-ValueType
transmembrane domain 15 37 N/A INTRINSIC
transmembrane domain 50 69 N/A INTRINSIC
transmembrane domain 111 133 N/A INTRINSIC
transmembrane domain 138 157 N/A INTRINSIC
transmembrane domain 167 184 N/A INTRINSIC
Coding Region Coverage
  • 1x: 100.0%
  • 3x: 99.9%
  • 10x: 99.6%
  • 20x: 98.7%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Glycosylation of cellular glycoconjugates occurs in the endoplasmic reticulum (ER) and Golgi compartment, and requires transport of nucleotide sugars from the cytosol into the lumen of the ER and Golgi by specific transporters. The protein encoded by this gene resides in the ER, and transports both UDP-glucuronic acid (UDP-GlcA) and UDP-N-acetylgalactosamine (UDP-GalNAc) from the cytoplasm to the ER lumen. It may participate in glucuronidation and/or chondroitin sulfate biosynthesis. Mutations in this gene are associated with Schneckenbecken dysplasia.[provided by RefSeq, Sep 2009]
PHENOTYPE: Mice homozygous for a null allele exhibit neonatal lethality and chondrodystrophy associated with impaired chondroitin sulfate biosynthesis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 72 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700014D04Rik C T 13: 59,741,623 M794I not run Het
1810024B03Rik T G 2: 127,186,790 D163A possibly damaging Het
Abce1 A T 8: 79,687,908 I454N probably damaging Het
Acaca A G 11: 84,371,513 I1980M probably damaging Het
Adgrb2 C T 4: 129,992,124 T19M probably benign Het
Agmo T A 12: 37,414,975 S417T probably benign Het
Akap8l T C 17: 32,333,094 E403G probably damaging Het
Art5 C T 7: 102,098,504 A23T possibly damaging Het
Atg9a T C 1: 75,184,560 T681A probably benign Het
Atp11b A G 3: 35,778,107 Q37R probably damaging Het
Atp2a2 T C 5: 122,491,766 E80G probably benign Het
AW551984 G A 9: 39,599,775 P172L possibly damaging Het
Bace1 C T 9: 45,858,445 R296C probably damaging Het
Ccser1 T A 6: 61,311,856 H334Q probably benign Het
Chtf18 C T 17: 25,723,517 R449H probably damaging Het
Cit A G 5: 115,984,822 H1384R possibly damaging Het
Cltc A G 11: 86,721,648 I524T probably benign Het
Dctn1 T A 6: 83,183,060 I94N probably damaging Het
Ddx58 T A 4: 40,206,034 I853F possibly damaging Het
Dnhd1 A T 7: 105,705,265 D3078V probably damaging Het
Dock7 G A 4: 99,055,446 P520S Het
Epb41l4a C A 18: 33,854,273 K350N probably damaging Het
Eprs T A 1: 185,413,169 Y1130N probably damaging Het
Fcgrt T C 7: 45,095,373 T224A probably damaging Het
Flt1 T A 5: 147,700,367 T39S probably benign Het
Fxyd1 T C 7: 31,053,471 Y33C probably damaging Het
Gab2 T A 7: 97,301,426 V442E probably damaging Het
Ganab A G 19: 8,914,712 D800G probably benign Het
Gata4 C A 14: 63,240,737 A138S probably benign Het
Golga4 A G 9: 118,556,063 H751R possibly damaging Het
Hist1h1t A G 13: 23,696,472 R203G possibly damaging Het
Htra4 A G 8: 25,037,077 V234A possibly damaging Het
Igkv4-74 A T 6: 69,184,970 Y72N probably damaging Het
Iqsec3 T C 6: 121,383,981 K973E probably damaging Het
Khdc1b C A 1: 21,384,841 T108K probably benign Het
Krtap5-1 ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG ACAGGGCTTGCAGCAGCTGGACTGACAGCAGCAGGGCTTGCAGCAGCTGGACTGACAGCAG 7: 142,296,596 probably benign Het
Kyat3 A G 3: 142,726,305 probably null Het
Lrba T A 3: 86,318,167 V666E probably damaging Het
Mettl25 T A 10: 105,766,010 Y528F probably benign Het
Mms19 A T 19: 41,952,465 Y619* probably null Het
Nlrp12 A C 7: 3,228,388 probably null Het
Nol10 C T 12: 17,424,675 L623F possibly damaging Het
Oas1g A G 5: 120,886,000 F82S probably damaging Het
Olfr1537 G A 9: 39,238,250 P58L probably benign Het
Olfr195 C T 16: 59,149,207 A119V probably damaging Het
Olfr335-ps T G 2: 36,301,760 S74A probably benign Het
Oxr1 G A 15: 41,823,467 E582K probably damaging Het
Pdia3 A G 2: 121,432,357 D268G possibly damaging Het
Pramef12 T C 4: 144,392,864 S378G probably damaging Het
Rcor3 A G 1: 192,101,778 Y387H probably damaging Het
Rsf1 CGGCGGCGG CGGCGGCGGGGGCGGCGG 7: 97,579,911 probably benign Het
Rsl1 T C 13: 67,182,220 L244P possibly damaging Het
Scn5a G T 9: 119,495,540 N1407K probably damaging Het
Sdcbp C T 4: 6,378,985 A24V probably benign Het
Slc22a8 A G 19: 8,593,959 Y18C possibly damaging Het
Slco6d1 A T 1: 98,497,523 T599S probably damaging Het
St18 T A 1: 6,802,537 H165Q probably benign Het
Sub1 C T 15: 11,986,503 R86K probably damaging Het
Tectb G A 19: 55,192,672 V148M Het
Tgfb2 C A 1: 186,630,757 G290V possibly damaging Het
Tgm7 T C 2: 121,093,710 H577R probably benign Het
Tle2 T C 10: 81,587,147 S460P probably damaging Het
Tmem221 C A 8: 71,558,802 R3L possibly damaging Het
Tnfrsf19 C A 14: 60,974,734 V156L possibly damaging Het
Trav6-5 A G 14: 53,491,507 K75E probably benign Het
Trip10 G A 17: 57,262,442 G488S probably damaging Het
Usp34 A C 11: 23,449,268 K2419T Het
Vps13d T C 4: 145,075,052 Q3532R Het
Vps4a A T 8: 107,040,897 I163L probably damaging Het
Wrn T C 8: 33,324,426 H330R probably benign Het
Xpr1 T C 1: 155,312,872 I341V probably benign Het
Zfyve9 T C 4: 108,691,776 E105G probably benign Het
Other mutations in Slc35d1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02088:Slc35d1 APN 4 103211325 missense probably benign 0.00
IGL03198:Slc35d1 APN 4 103184888 missense probably damaging 1.00
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0131:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0132:Slc35d1 UTSW 4 103208181 missense probably benign 0.01
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0206:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0208:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R0270:Slc35d1 UTSW 4 103190838 missense probably damaging 0.98
R0346:Slc35d1 UTSW 4 103190847 missense probably damaging 0.96
R0388:Slc35d1 UTSW 4 103184887 nonsense probably null
R0638:Slc35d1 UTSW 4 103213244 splice site probably benign
R2146:Slc35d1 UTSW 4 103205152 missense probably damaging 0.99
R3722:Slc35d1 UTSW 4 103208124 missense possibly damaging 0.93
R4649:Slc35d1 UTSW 4 103213229 missense probably damaging 1.00
R5137:Slc35d1 UTSW 4 103214781 missense possibly damaging 0.71
R5327:Slc35d1 UTSW 4 103213186 missense probably damaging 1.00
R5351:Slc35d1 UTSW 4 103189839 missense probably damaging 1.00
R5395:Slc35d1 UTSW 4 103211375 critical splice acceptor site probably null
R6263:Slc35d1 UTSW 4 103208168 missense possibly damaging 0.93
R6470:Slc35d1 UTSW 4 103189822 missense probably damaging 1.00
R7344:Slc35d1 UTSW 4 103213046 splice site probably null
R7388:Slc35d1 UTSW 4 103189785 critical splice donor site probably null
R7580:Slc35d1 UTSW 4 103208133 missense
R7942:Slc35d1 UTSW 4 103213163 critical splice donor site probably null
R8408:Slc35d1 UTSW 4 103189810 missense
R8444:Slc35d1 UTSW 4 103214699 missense
R8692:Slc35d1 UTSW 4 103189854 missense
R8730:Slc35d1 UTSW 4 103173754 missense
R8868:Slc35d1 UTSW 4 103208154 missense probably damaging 1.00
R8894:Slc35d1 UTSW 4 103211332 missense
Predicted Primers PCR Primer
(F):5'- ACGCTCTTGTTGACCACCAC -3'
(R):5'- AGGTACTTCTAGGCCTGCAG -3'

Sequencing Primer
(F):5'- TTGTTGACCACCACGATGAG -3'
(R):5'- AAGTCCCCGAGGGTGTGAAC -3'
Posted On2019-11-12